Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00023944
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001067(dpy-5)|WBGene00001075(dpy-14)|WBGene00004332(rec-1)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00001075(dpy-14), WBGene00004332(rec-1)
Availability: available
References:
Synonyms: dpy-5(e61) dpy-14(e188) rec-1(s180)? I; hDp30 (I;f).
Notes: Dpy-14 phenotype. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.|"spontaneous from hDp23"
Proper citation: RRID:WB-STRAIN:WBStrain00023944 Copy
http://www.wormbase.org/db/get?name=WBStrain00023945
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001067(dpy-5)|WBGene00001075(dpy-14)|WBGene00004332(rec-1)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00001075(dpy-14), WBGene00004332(rec-1)
Availability: available
References:
Synonyms: dpy-5(e61) dpy-14(e188) rec-1(s180)? I; hDp72 (I;f).
Notes: Animals with the duplication are Dpy. Animals which have lost the duplication are extremely Dpy. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.|"Made_by: K. McKim"
Proper citation: RRID:WB-STRAIN:WBStrain00023945 Copy
http://www.wormbase.org/db/get?name=WBStrain00023943
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001067(dpy-5)|WBGene00001075(dpy-14)|WBGene00004332(rec-1)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00001075(dpy-14), WBGene00004332(rec-1)
Availability: available
References:
Synonyms: dpy-5(e61) dpy-14(e188) rec-1(s180) I; hDp75 (I;f).
Notes: Made_by: McKim K|"Spontaneous from sDp2"|"Wild-type phenotype. Segregates WT, Dpy-5 Dpy-14 Rec-1. Presence of rec-1 not confirmed. Pick WT and check for correct segregation of progeny to maintain. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose."
Proper citation: RRID:WB-STRAIN:WBStrain00023943 Copy
http://www.wormbase.org/db/get?name=WBStrain00023949
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001067(dpy-5)|WBGene00001075(dpy-14)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00001075(dpy-14)
Availability: available
References:
Synonyms: dpy-5(e61) dpy-14(e188) I; hDp83 (I;IV).
Notes: Made_by: K. McKim|"Stable and homozygous viable. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose."
Proper citation: RRID:WB-STRAIN:WBStrain00023949 Copy
http://www.wormbase.org/db/get?name=WBStrain00023946
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001067(dpy-5)|WBGene00001075(dpy-14)|WBGene00004332(rec-1)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00001075(dpy-14), WBGene00004332(rec-1)
Availability: available
References:
Synonyms: dpy-5(e61) dpy-14(e188) rec-1(s180)? I; hDp20 (I;V).
Notes: Mutagen:gamma on sDp2|"WT. Dp carries Chromosome I and V left sequences. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose."
Proper citation: RRID:WB-STRAIN:WBStrain00023946 Copy
http://www.wormbase.org/db/get?name=WBStrain00023947
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001067(dpy-5)|WBGene00001069(dpy-7)|WBGene00006743(unc-3)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00001069(dpy-7), WBGene00006743(unc-3)
Availability: unknown
References:
Synonyms: +/hT3[dpy-5(e61)] I; dpy-7(e88) unc-3(e151)/hT3 X.
Notes: Heterozygotes are WT and segregate WT, DpyUncs and Dpys.|"Heterozygotes are WT and segregate WT, DpyUncs and Dpys. Balancer is quite unstable and prone to breaking down. Grows better at 15C."|"no longer available from the CGC."|"Supplementary_genotype +/hT3[dpy-5(e61)] I; dpy-7(e88) unc-3(e151)/hT3 X."
Proper citation: RRID:WB-STRAIN:WBStrain00023947 Copy
http://www.wormbase.org/db/get?name=WBStrain00005021
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00000254(bli-4)|WBGene00001067(dpy-5)|WBGene00006772(unc-36)
Genomic Alteration: WBGene00000254(bli-4), WBGene00001067(dpy-5), WBGene00006772(unc-36)
Availability: available
References:
Synonyms: dpy-5(e61)/hT2 [umnIs73] I; unc-36(e251)/hT2 [bli-4(e937) let-?(h661)] III.
Notes: umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Heterozygotes are WT mKate2+ and segregate WT mKate2+, DpyUnc, lethal mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Will throw an occasional mKate+ Dpy non-Unc (similar events were observed in the parental hT2 strain). Pick WT mKate2+ and check for correct segregation of progeny to maintain. Derived by insertion of myo-2p::mKate2 transgene into hT2 balancer in parental strain KR2467 using CRISPR/Cas9. [NOTE: 3/1995: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)]
Proper citation: RRID:WB-STRAIN:WBStrain00005021 Copy
http://www.wormbase.org/db/get?name=WBStrain00005015
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00000254(bli-4)|WBGene00001067(dpy-5)|WBGene00006772(unc-36)
Genomic Alteration: WBGene00000254(bli-4), WBGene00001067(dpy-5), WBGene00006772(unc-36)
Availability: available
References:
Synonyms: dpy-5(e61)/hT2 I; unc-36(e251)/hT2 [bli-4(e937) let-?(h661) umnIs67] III.
Notes: umnIs67 [myo-2p::GFP + NeoR, I: 6284001 (intergenic)] III. Heterozygotes are WT GFP+ and segregate WT GFP+, DpyUnc, lethal GFP+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Will throw an occasional GFP+ Dpy non-Unc (similar events were observed in the parental hT2 strain). Pick WT GFP+ and check for correct segregation of progeny to maintain. Derived by insertion of myo-2p::GFP transgene into hT2 balancer in parental strain KR2467 using CRISPR/Cas9. [NOTE: 3/1995: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)]
Proper citation: RRID:WB-STRAIN:WBStrain00005015 Copy
http://www.wormbase.org/db/get?name=WBStrain00005501
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001067(dpy-5)|WBGene00006791(unc-57)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00006791(unc-57)
Availability: available
References:
Synonyms: unc-57(ad592) dpy-5(e61) I.
Notes: DpyUnc. ad592 is Eat. Dpy is semi-dominant.
Proper citation: RRID:WB-STRAIN:WBStrain00005501 Copy
http://www.wormbase.org/db/get?name=WBStrain00005538
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001067(dpy-5)|WBGene00006765(unc-29)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00006765(unc-29)
Availability: available
References:
Synonyms: hDf10 dpy-5(e61) unc-29(e403) I; sDp2 (I;f).
Notes: Animals carrying sDp2 are Unc and segregate Unc and dead eggs.
Proper citation: RRID:WB-STRAIN:WBStrain00005538 Copy
http://www.wormbase.org/db/get?name=WBStrain00040443
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00000254(bli-4)|WBGene00001067(dpy-5)|WBGene00006752(unc-13)
Genomic Alteration: WBGene00000254(bli-4), WBGene00001067(dpy-5), WBGene00006752(unc-13)
Availability: available
References:
Synonyms: dpy-5(e61) unc-13(e51) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Notes: Heterozygotes are WT with pharyngeal GFP signal, and segragate WT GFP+, arrested hT2 aneuploids, and non-GFP Dpy Unc homozygotes. Homozygous hT2[bli-4 let-? qIs48] are inviable.
Proper citation: RRID:WB-STRAIN:WBStrain00040443 Copy
http://www.wormbase.org/db/get?name=WBStrain00037915
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001067(dpy-5)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00017816(hrpk-1)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00017816(hrpk-1)
Availability: available
References:
Synonyms: hrpk-1(gk5045[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/tmC18 [dpy-5(tmIs1236)] I.
Notes: Homozygous lethal deletion balanced by tmC18. Deletion of 1976 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TCAAAATGATGATCAAAGTGGGAGCCGCTA ; Right flanking sequence: GGTGGATCTGTCTAGGTTCTGGTGTTCGTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous sterile deletion balanced by tmC18. Heterozygotes are wild-type with pharyngeal GFP+RFP+, and segregate GFP+RFP+ heterozygotes, GFP+ gk5045 homozygotes (most commonly sterile, but occasional animals will lay eggs that hatch, and a population of homozygotes can be maintained), and tmC18 homozygotes (Dpy-5 with myo-2 mCherry). Pick fertile wild-type GFP+RFP+ to maintain. Deletion of 1976 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TCAAAATGATGATCAAAGTGGGAGCCGCTA ; Right flanking sequence: GGTGGATCTGTCTAGGTTCTGGTGTTCGTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: Vancouver KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00037915 Copy
http://www.wormbase.org/db/get?name=WBStrain00042266
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001067(dpy-5)
Genomic Alteration: WBGene00001067(dpy-5)
Availability: unknown
References:
Synonyms: dpy-5(e907) I; sIs13146.
Notes: Generated based on WC-CalTech XREF data|"No longer available from the CGC catalogue 24/04/2020"|"sIs13146 [rCes C02H7.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525)."
Proper citation: RRID:WB-STRAIN:WBStrain00042266 Copy
http://www.wormbase.org/db/get?name=WBStrain00040929
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001067(dpy-5)|WBGene00006797(unc-63)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00006797(unc-63)
Availability: available
References:
Synonyms: unc-63(x18) dpy-5(e61) I.
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00040929 Copy
http://www.wormbase.org/db/get?name=WBStrain00040931
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001067(dpy-5)|WBGene00006774(unc-38)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00006774(unc-38)
Availability: available
References:
Synonyms: unc-38(x20) dpy-5(e61) I.
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00040931 Copy
http://www.wormbase.org/db/get?name=WBStrain00003450
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001067(dpy-5)
Genomic Alteration: WBGene00001067(dpy-5)
Availability: available
References:
Synonyms: dpy-5(e907) I; sEx15319.
Notes: sEx15319 [rCesC54D10.10::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
Proper citation: RRID:WB-STRAIN:WBStrain00003450 Copy
http://www.wormbase.org/db/get?name=WBStrain00003449
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001067(dpy-5)
Genomic Alteration: WBGene00001067(dpy-5)
Availability: available
References:
Synonyms: dpy-5(e907) I; sEx15317.
Notes: sEx15317 [rCesZK896.8::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
Proper citation: RRID:WB-STRAIN:WBStrain00003449 Copy
http://www.wormbase.org/db/get?name=WBStrain00003447
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001067(dpy-5)|WBGene00019864(ceh-93)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00019864(ceh-93)
Availability: available
References:
Synonyms: dpy-5(e907) I; sEx15310.
Notes: Made_by: Baillie Lab|"sEx15310 [rCes R04A9.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525)."
Proper citation: RRID:WB-STRAIN:WBStrain00003447 Copy
http://www.wormbase.org/db/get?name=WBStrain00003445
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001067(dpy-5)|WBGene00012804(slc-36.1)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00012804(slc-36.1)
Availability: available
References:
Synonyms: dpy-5(e907) I; sEx15307.
Notes: Made_by: Baillie Lab|"sEx15307 [rCes Y43F4B.7::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525)."
Proper citation: RRID:WB-STRAIN:WBStrain00003445 Copy
http://www.wormbase.org/db/get?name=WBStrain00003446
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001067(dpy-5)
Genomic Alteration: WBGene00001067(dpy-5)
Availability: available
References:
Synonyms: dpy-5(e907) I; sEx15308.
Notes: sEx15308 [rCesM03C11.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
Proper citation: RRID:WB-STRAIN:WBStrain00003446 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
