Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
SD-Bsnem1Ionsz Resource Report Resource Website |
RRID:RGD_10450489 | Rattus norvegicus | CRISPR/Cas9 system was used to generate this mutant; sgRNA+Cas9+ plasmid was injected into zygote of SD rat that added a 2a-NpHR-EYFP-2a-ChR2-mcherry-ires-WGA-cre behind the last exon of Bsn Institute of Neuroscience, Chinese Academy of Sciences | 10450489 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 10450489 | 2026-02-14 03:50:03 | 0 | |||||
|
SD-Abcc6em5Qlju-/- Resource Report Resource Website |
RRID:RGD_10413858 | Rattus norvegicus | This strain was made by ZFN mutagenesis. ZFNs were designed to target exon 1 of rat Abcc6 gene at the binding site/cutting site 5-CACGCCTGGAGAGTCCTGcgcaggCCTGAGGGTGAGTCC-3 (c.24-c.62). The resulting mutation is a 11-bp deletion from cDNA position 39-49 (CTGCGCAGGCC). The mutation is predicted to cause out of frame translation and a premature stop codon. No protein in the homozygous mutant was detected by immunostaining. | 10413858 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 10413858 | 2026-02-14 03:50:03 | 0 | |||||
|
CV/Iet Resource Report Resource Website |
RRID:RGD_11041108 | Rattus norvegicus | The Laboratory of Reproductive Toxicology at the Institute of Environmental Toxicology has been maintaining a Wistar derived PD strain of rats. In 1986, 1 female and 2 males exhibiting very short and sparse vibrissae were found in a litter of 7 parented by a pd/pd female and phenotypically normal pd/+ male. In 2008, a male Wistar rat and F56 female were crossed, and obtained heterozygous rats were sib-mated. After that, sib mating between homozygous rats was started. National BioResource Project for the Rat in Japan | 11041108 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm | 11041108 | 2026-02-14 03:50:03 | 0 | |||||
|
SHR-Ndufc2em2Mcwi+/+ Resource Report Resource Website |
RRID:RGD_11040527 | Rattus norvegicus | ZFN mutant founders were backcrossed with SHR/NCrl to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. | 11040527 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 11040527 | 2026-02-14 03:50:04 | 0 | |||||
|
SHR-Ndufc2em1Mcwi+/+ Resource Report Resource Website |
RRID:RGD_11040525 | Rattus norvegicus | ZFN mutant founders were backcrossed with SHR/NCrl to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. | 11040525 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 11040525 | 2026-02-14 03:50:04 | 0 | |||||
|
F344-Tp53m1Kyo Resource Report Resource Website |
RRID:RGD_11040957 | Rattus norvegicus | This strain was established by ENU mutagenesis (gene-driven) using F344/NSlc and has a missense mutation（R271C). National BioResource Project for the Rat in Japan | 11040957 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm | 11040957 | 2026-02-14 03:50:03 | 0 | |||||
|
WKY-Slc39a12em77Tja+/- Resource Report Resource Website |
RRID:RGD_10401845 | Rattus norvegicus | ZFN mutant founders were backcrossed with WKY/Cruk to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. The resulting mutation 77 has a stop codon, 15 amino acids from the ZFN-binding site, that resulted in a 490 amino acids (54 kDa) truncated protein, 198 amino acids smaller than the WT protein. | 10401845 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 10401845 | 2026-02-14 03:50:03 | 0 | |||||
|
DWH/Iet Resource Report Resource Website 1+ mentions |
RRID:RGD_11040969 | Rattus norvegicus | derived from Wistar Hannover GALAS rats National BioResource Project for the Rat in Japan | 11040969 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Embryo | 11040969 | 2026-02-14 03:50:03 | 2 | |||||
|
Crl:WI-Lrapem1Geh Resource Report Resource Website |
RRID:RGD_11561897 | Rattus norvegicus | The CRISPR/Cas9 genome editing system was used to generate this knockout mutant rat strain. It created a 618-bp deletion in rat Lrap gene. The recipient zygotes were the Wistar rats from Charles River. | 11561897 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 11561897 | 2026-02-14 03:50:05 | 0 | |||||
|
SD-Il2rgem1Ang Resource Report Resource Website |
RRID:RGD_13628730 | Rattus norvegicus | TALEN targeting the 2nd exon of rat Il2rg gene was designed and mRNA coding these TALEN was microinjected into Crl:SD embyo.This strain carrying an 80 bp deletion generated a premature stop codon in the 3rd exon. No Il2rg protein was detected by western blot. | 13628730 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 13628730 | 2026-02-14 03:50:06 | 0 | |||||
|
SS-Adamts16em1Bj Resource Report Resource Website |
RRID:RGD_13437612 | Rattus norvegicus | This strain was produced by injecting ZFNs target sequence CCGCGGTTGCTTTGCGCTCTGGGTGCTGTTGCTGGCGCA into Dahl S rat eggs as . The resulting mutation is a 17-bp deletion of the sequence gctctgggtgctgttgc in exon 1. | 13437612 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 13437612 | 2026-02-14 03:50:06 | 0 | |||||
|
SD-Cdkn1bwe Resource Report Resource Website |
RRID:RGD_12910940 | Rattus norvegicus | The multiple endocrine neoplasia (MEN)-like phenotype was initially identified in a Sprague Dawley rat-breeding colony and subsequently maintained by matings between affected and nonaffected littermates. Because cataracts are the first visible sign of the phenotype it was provisionally designated as "Sprague Dawley white eye." The abbreviation SDwe is used to denote animals expressing the mutant phenotype. | 12910940 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 12910940 | 2026-02-14 03:50:06 | 0 | |||||
|
SD-Cacna1f csnb Resource Report Resource Website |
RRID:RGD_13782371 | Rattus norvegicus | A naturally-occurring mutation in Cacna1f was identified in a male Sprague Dawley rat with the phenotype of congenital stationary night blindness.Sequence analysis revealed a point mutation of C to T at position 2941, which changes codon 981 from arginine (CGA) to a stop codon (TGA). This R981Stop point mutation was predicted to lead to a version of protein shortened by a total of 999 amino acids, and missing the C-terminal and, in particular, part of the third and all of the fourth ion transport domains. | 13782371 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 13782371 | 2026-02-14 03:50:07 | 0 | |||||
|
SD-Dmdem1Ang Resource Report Resource Website |
RRID:RGD_12880037 | Rattus norvegicus | This mutant strain was generated by injecting TALEN targeting exon23 of rat Dmd into Crl:SD embryo. The resulting mutant is a 11 bp-deletion in exon 23 leading to a +1 grame shift and premature stop codon 81 bp after the mutation. | 12880037 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 12880037 | 2026-02-14 03:50:07 | 0 | |||||
|
WKY-Cyp2j4em1Sage/Tja Resource Report Resource Website 1+ mentions |
RRID:RGD_12904679 | Rattus norvegicus | ZFN system was used to introduce a 25-bp deletion mutation in the exon 4 of Cyp2j4 gene of WKY/NCrl rat embryos. This deletion results in premature stop of protein translation. | 12904679 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 12904679 | 2026-02-14 03:50:06 | 1 | |||||
|
F344-Hsd11b2em1Jmul-/- Resource Report Resource Website |
RRID:RGD_13800556 | Rattus norvegicus | The ZFN system targeting exon 2 of Hsd11b2 gene was injected into the F344/IcoCrl embryos to induce a 123-bp deletion removing the 3' end of exon 2 and the first 16-bp of intron B and create a premature stop coden TAG. | 13800556 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 13800556 | 2026-02-14 03:50:07 | 0 | |||||
|
SD-Mmp12em2Soar Resource Report Resource Website |
RRID:RGD_12910505 | Rattus norvegicus | TALEN mediated 607 bp deletion that includes exon 2 of the Mmp12 gene, resulting in a frameshift and premature stop codon | 12910505 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 12910505 | 2026-02-14 03:50:06 | 0 | |||||
|
F344-Hsd11b2em1Jmul+/+ Resource Report Resource Website 1+ mentions |
RRID:RGD_13800557 | Rattus norvegicus | This is the wild-type litter mates of the Hsd11b2 F344 mutants created by ZFN system targeting exon 2 of Hsd11b2 gene was injected into the F344/IcoCrl embryos to induce a 123-bp deletion removing the 3' end of exon 2 and the first 16-bp of intron B and create a premature stop coden TAG. | 13800557 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 13800557 | 2026-02-14 03:50:07 | 1 | |||||
|
BN-Crb1m1 Resource Report Resource Website |
RRID:RGD_13451132 | Rattus norvegicus | This Brown Norway from Janvier rat strain spontaneously develops progressive focal retinal layer disorganization, loss of photoreceptors, cystic cavitation, and RMG abnormalities associated with early retinal vascular telangiectasia and late stage subretinal neovascularization. This phenotype bears reminiscent of human Macular telangiectasia 2. A deletion insertion mutation in exon 6 of the rat crb1 was identified to be responsible for this retinal phenotype. | 13451132 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 13451132 | 2026-02-14 03:50:07 | 0 | |||||
|
SD-Trpv1em1Sage+/+ Resource Report Resource Website |
RRID:RGD_13792705 | Rattus norvegicus | These ZFN mutant rats were produced by injecting zinc finger nuclease targeting exon 13 of rat Trpv1 into Sprague Dawley embryos. A 2-bp (CA) frameshift deletion in exon 13 was created ( SD-Trpv1em1Sage-/-). This wild type mutant is the wild type offspring from the cross of heterozygous mutants. | 13792705 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 13792705 | 2026-02-14 03:50:07 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
