Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
bmdSi245 I; hda-1(bmd134[HDA-1::GFP::loxP]) V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00054713 | Caenorhabditis elegans | bmdSi245 I; hda-1(bmd134[HDA-1::GFP::loxP]) V. | bmdSi245 [^SEC^lin-29p::mKate2-STOP-STOP-DAMc1::VHH4GFP] I. Relatively slow growth compared to N2 animals. NanoDam toolkit will allows identification of direct genomic targets of TFs as well as chromatin modifiers. In this system, Dam methylase is fused with a binding reagent, an anti-GFP nanobody (vhhGFP4). Thus, genome-wide profiling can be achieved by combining cell type-specific Dam::vhhGFP4 fusion constructs with GFP knock-in alleles.|"Made_by: Yutong Xiao" | WBGene00001834(hda-1) | WBGene00001834(hda-1) | WB-STRAIN:WBStrain00054713 | WormBase (WB) | WB | unknown | EMPTY | 2026-02-07 12:30:07 | 0 | |||
|
ubh-4(cer140) rpn-9(gk401)/mIn1 [mIs14 dpy-10(e128)] II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00054676 | Caenorhabditis elegans | ubh-4(cer140) rpn-9(gk401)/mIn1 [mIs14 dpy-10(e128)] II. | Homozygous viable mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP cer140 gk401 homozygotes (synthetic sterile). Pick WT dim GFP and check for correct segregation of progeny to maintain. Generated by CRISPR-mediated deletion of ubh-4 in gk401 mutant background. Reference: Martinez-Fernandez C, et al. Cells. 2023 Mar 18;12(6):929. doi: 10.3390/cells12060929. PMID: 36980270|"Made_by: Carmen Martnez-Fernndez" | WBGene00001072(dpy-10)|WBGene00004465(rpn-9)|WBGene00006724(ubh-4) | WBGene00001072(dpy-10), WBGene00004465(rpn-9), WBGene00006724(ubh-4) | WB-STRAIN:WBStrain00054676 | WormBase (WB) | WB | unknown | EMPTY | 2026-02-07 12:29:58 | 0 | |||
|
bmdSi282. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00054712 | Caenorhabditis elegans | bmdSi282. | bmdSi282 [^loxN^rgef-1p::mKate2-STOP-STOP-VHH4GFP::DAMc1]. Wild-type growth and movement. NanoDam toolkit will allows identification of direct genomic targets of TFs as well as chromatin modifiers. In this system, Dam methylase is fused with a binding reagent, an anti-GFP nanobody (vhhGFP4). Thus, genome-wide profiling can be achieved by combining cell type-specific Dam::vhhGFP4 fusion constructs with GFP knock-in alleles.|"Made_by: Taylor N. Medwig-Kinney" | WB-STRAIN:WBStrain00054712 | WormBase (WB) | WB | unknown | EMPTY | 2026-02-07 12:29:59 | 0 | |||||
|
cat-2(cer181[cat-2p::GFP::H2B 1-3]) II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00054678 | Caenorhabditis elegans | cat-2(cer181[cat-2p::GFP::H2B 1-3]) II. | Abnormal locomotion can be rescued with dopamine. cat-2(cer181) is a complete deletion of the cat-2 gene (coding sequence + introns), which was substituted by the sequence of the step 1 repair for GFP::H2B (Nested CRISPR, Vicencio et al, Genetics 2019). Allele can be detected using the following primers: Fwd: ctatgtgaagtcacacctgtc Rev: cttgctggaagtgtacttggtg. Reference: Martnez-Fernndez C, et al. Dis Model Mech. 2022 Mar 1;15(3):dmm049161. doi: 10.1242/dmm.049161. PMID: 35107130|"Made_by: Carmen Martnez-Fernndez" | WBGene00000296(cat-2) | WBGene00000296(cat-2) | WB-STRAIN:WBStrain00054678 | WormBase (WB) | WB | unknown | EMPTY | 2026-02-07 12:30:14 | 0 | |||
|
bmdSi284 I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00054711 | Caenorhabditis elegans | bmdSi284 I. | bmdSi284 [loxN::rpl-28p::TIR1(F79G)::T2A::DHB::2xmKate2] I. bmdSi284 is a single copy CRISPR/Cas9 insertion that ubiquitously co-expresses the mutant version of TIR1 for improved auxin-inducible degradation via 5-Ph-IAA and a CDK activity sensor consisting of a fragment of human DNA helicase B (DHB) fused to two copies of mKate2. Reference: Martinez MAQ, et al. Biology Open. 2022 Dec 15;11(12):bio059668. doi: 10.1242/bio.059668.|"Made_by: Michael Martinez" | WB-STRAIN:WBStrain00054711 | WormBase (WB) | WB | unknown | EMPTY | 2026-02-07 12:30:14 | 0 | |||||
|
bmdSi327 I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00054718 | Caenorhabditis elegans | bmdSi327 I. | bmdSi327 [loxN::ckb-3p::FLP::P2A::H2B::2xmTurq2]; inserted into safe harbor site ttTi4348 in Chr I. Uterine-specific expression of FLPase in Z1/Z4 and their descendants with blue fluorescent histone reporter for visualization. Reference: Xiao Y, et al. An expandable FLP-ON::TIR1 system for precise spatiotemporal protein degradation in C. elegans. bioRxiv 2022.10.14.512315; doi: https:|"Made_by: Matus Lab" | WB-STRAIN:WBStrain00054718 | WormBase (WB) | WB | unknown | EMPTY | 2026-02-07 12:29:59 | 0 | |||||
|
dpff-1(bmd302[dpff-1p::^SEC^mNG::AID::DPFF-1]) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00054717 | Caenorhabditis elegans | dpff-1(bmd302[dpff-1p::^SEC^mNG::AID::DPFF-1]) III. | Made_by: Yutong Xiao|"Pick Rollers to maintain. Endogenous N-term tagged DPFF-1 with mNG::AID using the self-excising cassette for drug selection. Animals are rollers which contains sqt-1 gene. Remove the SEC for normal expression using the protocol described in Dickinson DJ, Pani AM, Heppert JK, Higgins CD, Goldstein B. Streamlined Genome Engineering with a Self-Excising Drug Selection Cassette. Genetics. 2015 Aug;200(4):1035-49. doi: 10.1534/genetics.115.178335. Epub 2015 Jun 3. PMID: 26044593; PMCID: PMC4574250." | WBGene00016200(dpff-1) | WBGene00016200(dpff-1) | WB-STRAIN:WBStrain00054717 | WormBase (WB) | WB | unknown | EMPTY | 2026-02-07 12:30:15 | 0 | |||
|
bmdSi346 I; bmdSi297 II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00054719 | Caenorhabditis elegans | bmdSi346 I; bmdSi297 II. | bmdSi346 [loxN::lin-31p::FLP]; inserted into safe harbor site ttTi4348 in Chr I. bmdSi297 [loxN::rpl-28p::FRT3::STOP::FRT3::TIR1(F79G)::T2A::DHB::2xmKate2]; inserted into safe harbor site ttTi5605 in Chr II. FLP-ON::TIR1 system for AID-tagged protein degradation in VPCs. High levels of TIR1(F79G) expression in vulval precursor cells by lin-31p::FLP with co-expression of CDK activity sensor. bmdSi297 contains the ubiquitous rpl-28 promoter driving expression of FRT3::STOP::FRT3::TIR1(F79G)::DHB construct dependent upon tissue-specific FLPase. High levels of TIR1(F79G) can be expressed in specific tissue or cell types via FLPase activity, allowing spatiotemporally-targeted degradation of AID-tagged proteins. Reference: Xiao Y, et al. An expandable FLP-ON::TIR1 system for precise spatiotemporal protein degradation in C. elegans. bioRxiv 2022.10.14.512315; doi: https:|"Made_by: Matus Lab" | WB-STRAIN:WBStrain00054719 | WormBase (WB) | WB | unknown | EMPTY | 2026-02-07 12:30:07 | 0 | |||||
|
acEx185. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00054663 | Caenorhabditis elegans | acEx185. | acEx185 [hsp-16.41p::par-5::VN173 + hsp-16.41p::his-1::VC155 + unc-122p::RFP]. Pick RFP+ animals to maintain. BiFC reporter strain for PAR-5 and histone (H4) proteins interaction. To detect the protein-protein physical interactions, heat shock the animals for 3 hours at 33C, allow them to recover for 12 hours at 20C, and observe fluorescent-complementation signals under a high-magnification fluorescence microscope. Reference: Hong C, et al. PLoS Biol. 2021 Mar 31;19(3):e3001169. doi: 10.1371/journal.pbio.3001169. PMID: 33788830.|"Made_by: Jonathan Lalsiamthara" | WB-STRAIN:WBStrain00054663 | WormBase (WB) | WB | unknown | EMPTY | 2026-02-07 12:30:14 | 0 | |||||
|
endu-2(tm4977) X; byEx1375. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00054669 | Caenorhabditis elegans | endu-2(tm4977) X; byEx1375. | byEx1375 [endu-2p::endu-2::eGFP + myo-2p::mCherry]. Pick mCherry+ animals to maintain array. Transgene rescues mortal germline (Mrt) phenotype of endu-2(tm4977). Reference: Qi W, et al. (2020) A secreted endoribonuclease ENDU-2 from the soma protects germline immortality in C. elegans. BioRxiv. doi: 10.1101/2020.12.04.408260. Accepted by Nature Communications. | WBGene00019779(endu-2) | WBGene00019779(endu-2) | WB-STRAIN:WBStrain00054669 | WormBase (WB) | WB | unknown | PMID:37443152 | 2026-02-07 12:30:14 | 0 | |||
|
syd-2(ju487) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00054705 | Caenorhabditis elegans | syd-2(ju487) X. | ju487 is a gain-of-function allele of syd-2, changing Arg184 to Cys. Reference: Dai Y, et al. Nat Neurosci. 2006 Dec;9(12):1479-87. doi: 10.1038/nn1808. PMID: 17115037.|"Made_by: Ya Dai, Yishi Jin" | WBGene00006364(syd-2) | WBGene00006364(syd-2) | WB-STRAIN:WBStrain00054705 | WormBase (WB) | WB | unknown | EMPTY | 2026-02-07 12:30:14 | 0 | |||
|
muIs32 II; degt-1(ok3307) V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00054704 | Caenorhabditis elegans | muIs32 II; degt-1(ok3307) V. | Made_by: Eugene Jennifer Jin|"muIs32 [mec-7p::GFP + lin-15(+)]. GFP-labeled touch receptor neurons showing wild-type-like morphology. Derived by out-crossing parental ok3307 strain to remove a linked mutation in rpm-1. Reference: Jin EJ & Jin Y. (2022). A mutation linked to degt-1(ok3307) in C. elegans strain VC2633 affects rpm-1. microPublication Biology. 10.17912/micropub.biology.000565. PMC ID: PMC9073554.]" | WBGene00009109(degt-1) | WBGene00009109(degt-1) | WB-STRAIN:WBStrain00054704 | WormBase (WB) | WB | unknown | EMPTY | 2026-02-07 12:30:07 | 0 | |||
|
unc-26(pek288[R216Q]) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00054666 | Caenorhabditis elegans | unc-26(pek288[R216Q]) IV. | Made_by: Sisi Yang|"unc-26(pek288) is a CRISPR-engineered R216Q substitution in unc-26/synaptojanin 1 associated with early-onset Parkinsonism (EOP) (Quadri et al., 2013; Krebs et al., 2013). This allele shows abnormal focal accumulation of ATG-9 in presynaptic nerve terminals, defects in activity-induced synaptic autophagy, and defects in sustained neurotransmission and locomotory behaviors in aging animals. Reference: Yang S, et al. Neuron. 2022 Mar 2;110(5):824-840.e10. PMID: 35065714" | WBGene00006763(unc-26) | WBGene00006763(unc-26) | WB-STRAIN:WBStrain00054666 | WormBase (WB) | WB | unknown | EMPTY | 2026-02-07 12:30:14 | 0 | |||
|
bqSi577 IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00054665 | Caenorhabditis elegans | bqSi577 IV. | bqSi577 [myo-2p::GFP + unc-119(+)] IV. Expresses GFP in pharyngeal muscles. Single-copy insertion in the MosSCI locus cxTi10882 on chromosome IV. Obtained via the outcrossing of strain BN578 with N2. Reference: Toker IA, et al. Dev Cell. 2022 Feb 7;57(3):298-309.e9. PMID: 35134343.|"Made_by: Itai Toker" | WB-STRAIN:WBStrain00054665 | WormBase (WB) | WB | unknown | EMPTY | 2026-02-07 12:30:07 | 0 | |||||
|
endu-2(by190[endu-2::eGFP]) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00054668 | Caenorhabditis elegans | endu-2(by190[endu-2::eGFP]) X. | eGFP tag inserted into the endogenous endu-2 locus. Reference: Qi W, et al. (2020) A secreted endoribonuclease ENDU-2 from the soma protects germline immortality in C. elegans. BioRxiv. doi: 10.1101/2020.12.04.408260. Accepted by Nature Communications. | WBGene00019779(endu-2) | WBGene00019779(endu-2) | WB-STRAIN:WBStrain00054668 | WormBase (WB) | WB | unknown | PMID:37443152 | 2026-02-07 12:30:07 | 0 | |||
|
shc-1(ok198) I; zIs356 IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00054667 | Caenorhabditis elegans | shc-1(ok198) I; zIs356 IV. | zIs356 [daf-16p::daf-16a/b::GFP + rol-6(su1006)] IV. Tumorous germline with degeneration of surrounding extracellular matrix & disrupted gonadal basement membrane. Reference: Qi W, et al. PLoS Genet. 2012;8(8):e1002836. doi: 10.1371/journal.pgen.1002836. | WBGene00018788(shc-1) | WBGene00018788(shc-1) | WB-STRAIN:WBStrain00054667 | WormBase (WB) | WB | unknown | EMPTY | 2026-02-07 12:29:58 | 0 | |||
|
juIs145 II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00054700 | Caenorhabditis elegans | juIs145 II. | juIs145 [flp-13p::GFP + lin-15(+)] II. GFP expression in ASE, ASG, ASK, I5 and DD1-DD6. Reference: Wu Z, et al. Proc Natl Acad Sci USA. 2007 Sep 18;104(38):15132-7. PMID: 17848506. | WB-STRAIN:WBStrain00054700 | WormBase (WB) | WB | unknown | EMPTY | 2026-02-07 12:29:58 | 0 | |||||
|
pod-2(tn1765[gfp::3xflag::pod-2]) II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00054709 | Caenorhabditis elegans | pod-2(tn1765[gfp::3xflag::pod-2]) II. | Homozygous viable, gfp expression in intestine, hypodermis, somatic gonad, excretory duct, CAN neuron. Reference: Starich et al. eLife 2020;9:e58619. DOI: https: | WBGene00004076(pod-2) | WBGene00004076(pod-2) | WB-STRAIN:WBStrain00054709 | WormBase (WB) | WB | unknown | EMPTY | 2026-02-07 12:29:58 | 0 | |||
|
lite1(ce314) X; domIs355. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00054708 | Caenorhabditis elegans | lite1(ce314) X; domIs355. | domIs355 [mec3p::QF + mec4p::QS + QUAS::CoChR::GFP + unc122p::RFP]. High sensitivity blue-light optogenetic line for FLP neurons. Transgenic animals expressing the high-sensitivity blue light-activated channelrhodopsin CoChR into FLP using the Q-system combining mec-3p and mec-4p promoters. In animals grown on all trans-retinal-containing medium, low intensity blue light stimuli trigger reversal responses. Animals have red coelomocytes. The transgene was integrated with UV, and outcrossed 2x to parental ce314 mutant strain KG1180. Reference: Schild LC & Glauser DA. Genetics. 2015 Aug;200(4):1029-34. doi: 10.1534/genetics.115.177956. PMID: 26022242. | WB-STRAIN:WBStrain00054708 | WormBase (WB) | WB | unknown | EMPTY | 2026-02-07 12:30:14 | 0 | |||||
|
sart-3(tm6688)/tmC9 [F36H1.2(tmIs1221)] IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00054651 | Caenorhabditis elegans | sart-3(tm6688)/tmC9 [F36H1.2(tmIs1221)] IV. | Homozygous sterile deletion balanced by tmC9 [F36H1.2(tmIs1221[myo-2p::Venus])]. Heterozygotes are wild-type Venus+ in pharynx, and segregate wild-type Venus+ heterozygotes, non-Venus Sterile (tm6688 homozygotes), and Venus+ Mec Unc (tmC9 homozygotes). Pick viable fertile Venus+ animals and check for correct segregation of progeny to maintain. Reference: Furuta T & Arur S. 2023. sart-3 functions to regulate germline sex determination in C. elegans. microPublication Biology. PubMed ID: 37206989. | WBGene00007111(sart-3) | WBGene00007111(sart-3) | WB-STRAIN:WBStrain00054651 | WormBase (WB) | WB | unknown | EMPTY | 2026-02-07 12:30:14 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
