Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=38676450
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Live Animals; Cryopreserved Sperm (as of 2021-07-01)
References:
Synonyms:
Notes: In 2013, F344/Stm female rat deleted 392b (delta392) of KIAA1045 (Phf24) was generated by Platinum TALEN methods. Although spontaneous GTCS is not observed, seizure susceptibility is increased and kindling induced by PTZ is promoted. In addition, locomotor activity is increased, disturbed behavior and spacial memory are decreased, and emotional behavior is increased due to unpleasant stimulation. National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_38676450 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=149735562
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2021-07-22)
References:
Synonyms:
Notes: Knockout rats in which the Gad2 gene was disrupted using the TALEN. In this strain, the Gad2 gene encoding GAD65 was knocked out. In homozygous rats, a high rate of epileptic seizures was observed at 2 to 3 weeks of age. National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_149735562 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=150429814
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Embryo (as of 2025-09-04)
References:
Synonyms:
Notes: The heterozygousGnal mutant rats were created by CRISPR/Cas9. Guide RNA sequences targeting the first exon of the rat Gnal gene isoform 2 were designed. The mutated allele contained a 13- bp deletion in exon1 that corresponded to
position 34 to 46 downstream of the translation start point ATG of the
Gnal splicing variant 2 was detected resulting in an early stop at position
150 and producing a truncated protein with 50 amino acids . European Mouse Mutant Archive(EMMA)
Proper citation: RRID:RGD_150429814 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=14394504
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown (as of 2019-03-25)
References:
Synonyms:
Notes: CRISPR/Cas9 system was used to introduce a 102-bp deletion in exon 2 in SHR/NCrl embryos. Contact MCW rat distribution at mcwcustomrats@mcw.edu
Proper citation: RRID:RGD_14394504 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=41457452
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Live Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2021-02-24)
References:
Synonyms:
Notes: Prdm14 mutation was induced by introducing ribonucleic complexes (crRNA, tract RNA and Cas9 protein) into Crlj:WI rat embryos using electroporator. The resulting mutation is a 4412-bp deletion in exon 1 to 4. Homozygous Prdm14 knocked-out rats have the germ cell-deficient phenotype. Section of Mammalian Transgenesis, Center for Genetic Analysis of Behavior, National Institute for Physiological Sciences, Okazaki Aichi, JAPAN
Proper citation: RRID:RGD_41457452 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=39128166
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2020-09-23)
References:
Synonyms:
Notes: By CRISPR/Cas9 system, mutation was introduced in Sparc gene of Wistar-Imamichi rat. 7 bp deletion around Exon7. National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_39128166 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=39128162
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2020-09-23)
References:
Synonyms:
Notes: By CRISPR/Cas9 system, mutation was introduced in Cspg4 gene of Wistar-Imamichi rat. 7 bp deletion on Exon1. National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_39128162 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=38599190
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Embryo (as of 2020-09-14)
References:
Synonyms:
Notes: This strain was established by targeting Il2rg gene and Rag2 gene in F344/Jcl using CRISPR/Cas9 system. gRNA seq to Il2rg: CCAACCTCACTATGCACTATAGG (PAM: first CCA); gRNA to Rag2: AACATAGCCTTAATTCAACCAGG (PAM: last AGG); Cas 9 mRNA transcribed from T7-NLS hCas9-pA (RDB13130) was used for the system. Gene transfer was performed by electroporation.This strain shows severe combined immunodeficiency (SCID) caused by 5-bp deletion in Il2rg gene on X chromosome and 1-bp insertion in Rag2 gene on chromosome 3. This strain grows normally under SPF condition. The sexual maturation is a bit late. National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_38599190 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=18182946
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2020-01-14)
References:
Synonyms:
Notes: CRISPR/Cas9 mediated gene editing was used to delete a 130,921bp region of the VWF gene in DahlSS/Mcw (SS/JrHsdMcwi ) rat embryos Contact MCW rat distribution at mcwcustomrats@mcw.edu
Proper citation: RRID:RGD_18182946 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=35668859
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Live Animals (as of 2020-07-09)
References:
Synonyms:
Notes: This model was generated using zinc finger nuclease (ZFN) method. Cre recombinase was expressed under the control of the endogenous Gnrh1 gene by inserting an internal ribosomal entry site (IRES)-Cre cassette 30bp downstream from the translational stop site of the Gnrh1 open reading frame. This was achieved by pronuclear co-injection of zinc finger nucleases (ATCCACAACATCCGAGTGtgacattGACGCTGAGATCCATGAC; cleavage site in lower case) along with a donor plasmid containing two 800bp homologous arms (HA) flanking IRES-Cre into a one-cell stage rat embryo. (1.) Allan Herbison at Department of Physiology, Development and Neuroscience, University of Cambridge, Cambridge, UK.; (2.) Vincent Prevot in INSERM, Lille, France.
Proper citation: RRID:RGD_35668859 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=14394518
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Live Animals; Cryopreserved Sperm (as of 2025-02-20)
References:
Synonyms:
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Arid1b gene of Crl:LE rat embryos. The resulting mutation is deletion of exon 4. Autism Rat Model Resource, Contact MCW rat distribution at mcwcustomrats@mcw.edu
Proper citation: RRID:RGD_14394518 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=38676254
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2020-09-16)
References:
Synonyms:
Notes: By using ENU mutagenesis followed by MuT-POWER screening of the KURMA (Kyoto University Rat Mutant Archive) samples, the depositors generated a heterozygous PPARg mutant (Ppargmkyo/+) rat with a missense mutation (G488T p.C163F in Pparg1 or G578T p.C193F for Pparg2) in Pparg. The PpargG488T homozygous rats are embryonic lethal. Heterozygous Ppargmkyo/+ rats showed reduced fat mass with adipocyte hypertrophy and insulin resistance, which were highly predictable from known actions of Pparg agonists and phenotypes of patients with the PPARG mutation. National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_38676254 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=36174225
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2020-07-29)
References:
Synonyms:
Notes: Hamp KO, Sprague-Dawley rats were generated by Transposagen Biopharmaceuticals (Lexington, KY). Four different genetically engineered rat lines, each with different sized Hamp deletions (with or without concurrent insertions), were created using TALEN technology. SD-Hamp em4Jfcol +/- (RGD:36174225) is heterozygous carrying a 15-bp deletion in exon 2 of the rat Hamp gene Rat Resource & Research Center (RRRC)
Proper citation: RRID:RGD_36174225 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=38676253
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2020-09-16)
References:
Synonyms:
Notes: TALEN (Left: ttcagAATGATTCATGGG, Right : ACGCACTCTTCAAAGCTA) targeting the exon4 of hyperpolarization-activated cyclic nucleotide-gated 1 channel (Hcn1) gene was designed and mRNA coding these TALEN was microinjected into F344/NSlc embyo. A 7-bp deletion in the exon4 of Hcn1 gene: as a result of frameshift mutation, stop codon is produced. Decreased expression levels of Hcn1 gene and HCN1 protein. National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_38676253 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=38676251
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2020-09-16)
References:
Synonyms:
Notes: TALEN (Left: ttcagAATGATTCATGGG, Right : ACGCACTCTTCAAAGCTA) targeting the exon4 of hyperpolarization-activated cyclic nucleotide-gated 1 channel (Hcn1) gene was designed and mRNA coding these TALEN was microinjected into F344/NSlc embyo. A 24-bp deletion in the exon4 of Hcn1 gene. It is predicted that 8 amino-acid deleted HCN1 protein is expressed. National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_38676251 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=150520216
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Live Animals (as of 2021-11-05)
References:
Synonyms:
Notes: Using CRISPR/Cas9, a suspected enhancer of miR1208 was deleted in a 8315bp excision in ACI rat embryos.
Proper citation: RRID:RGD_150520216 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=150429615
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown (as of 2021-09-09)
References:
Synonyms:
Notes: ZFN system was used to Knock out the rat Add3 gene of Crl:SD rat embryos.The ZFN mRNA was injected into the pronucleus of fertilized SpragueDawley embryos and transferred to the oviduct of pseudopregnant females. PCR genotyping of tail biopsies confirmed a 14-bp deletion using forward primer 5'-GCCCCCATGAGTCACTACAC-3' and reverse primer 5'-GCTACAGGAAGCATCTCCTGTG-3'. Founders with Add3 deletion were backcrossed to the parental strain to generate heterozygous F1 rats. Heterozygous F1 siblings were then intercrossed to derive a homozygous KO line used
Proper citation: RRID:RGD_150429615 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=14394508
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2019-03-25)
References:
Synonyms:
Notes: CRISPR/Cas9 system was used to introduce a 5-bp deletion in exon2 in the Tlr4 gene of BBDR.BBDP-(D4Mit6-D4Mit7)/RhwMcwi embryos. Contact MCW rat distribution at mcwcustomrats@mcw.edu
Proper citation: RRID:RGD_14394508 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=39128170
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2020-09-23)
References:
Synonyms:
Notes: "This strain was generated by co-introducing fertilized eggs of SHRSP/Izm with the guide RNA/Cas9 nuclease expression plasmid and ssODN, which targets the Stim1 gene, at the Institute of Laboratory Animals, Graduate School of Medicine, Kyoto University. SHRSP/Izm strain has a nonsense mutation (c.1918C>T, p.Arg640X) in the Stim1 gene, but homologous recombination with the introduced ssODN replaces this mutation with a normal sequence.
The sequence of the guide RNA target site is as follows,
Stim1: 5'-GCAGGGTAGCTGAAACACAC-3'
The sequence of the ssODN for homologous recombination is as follows,
5'-ATAGCCTTCTTGCCAGCCAAGTGGGGAATTCGTGTGTTTCGGCTACCCTGCAGGGCTCGGCTGTCCCCAACTGGAGATGGCCATCTCCAGTTGGGGACAGCCGAGCCCTGCAGGGTAGCCGAAACACACGAATTCCCCACTTGGCTGGCAAGAAGGCTAT-3'" National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_39128170 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=36174222
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2020-07-29)
References:
Synonyms:
Notes: Hamp KO, Sprague-Dawley rats were generated by Transposagen Biopharmaceuticals (Lexington, KY). Four different genetically engineered rat lines, each with different sized Hamp deletions (with or without concurrent insertions), were created using TALEN technology. SD-Hamp em2Jfcol -/- (RGD:36174222) is homozygous carrying a 230-bp deletion and a 1-bp insertion between exons 2 & 3 of both rat Hamp alleles. Rat Resource & Research Center (RRRC)
Proper citation: RRID:RGD_36174222 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
