Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
FHH-Klf6m1Mcwi Resource Report Resource Website |
RRID:RGD_1579712 | Rattus norvegicus | Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. V135G mutation is generated. | 1579712 | mutant | Rat Genome Database (RGD) | RGD | Extinct (as of 2017-01-26) | 1579712 | 2026-02-17 10:58:37 | 0 | |||||
|
BN-Birc3m1Mcwi Resource Report Resource Website |
RRID:RGD_1579681 | Rattus norvegicus | Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations.W76G mutation is generated. | 1579681 | mutant | Rat Genome Database (RGD) | RGD | Extinct (as of 2016-10-24) | 1579681 | 2026-02-17 10:58:38 | 0 | |||||
|
FHH-Nr4a1m1Mcwi Resource Report Resource Website |
RRID:RGD_1579706 | Rattus norvegicus | Male founders (FHH/EurMcwi) were injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups were genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. Y130Stop mutation was generated from the codon change TAC/TAA. | 1579706 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2017-01-26) | 1579706 | 2026-02-17 10:58:38 | 0 | |||||
|
SS-Arhgef11em5Mcwi Resource Report Resource Website |
RRID:RGD_10054296 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a mutation in the Arhgef11 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp deletion in the Arhgef11 gene. Contact MCW rat distribution at mcwcustomrats@mcw.edu | 10054296 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2018-10-22) | 10054296 | 2026-02-17 10:58:33 | 0 | |||||
|
SS-Sirt3em4Mcwi Resource Report Resource Website |
RRID:RGD_10054453 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a mutation in the Sirt3 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp deletion in the Sirt3 gene. Contact MCW rat distribution at mcwcustomrats@mcw.edu | 10054453 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2017-01-26) | 10054453 | 2026-02-17 10:58:33 | 0 | |||||
|
T2DN-Sirt3em35Mcwi Resource Report Resource Website |
RRID:RGD_10054456 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a mutation in the Sirt3 gene of T2DN/Mcwi rat embryos. The resulting mutation is a 82-bp deletion of exon 3 in the Sirt3 gene. Contact MCW rat distribution at mcwcustomrats@mcw.edu | 10054456 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2018-10-22) | 10054456 | 2026-02-17 10:58:33 | 0 | |||||
|
SS-Sirt3em25Mcwi Resource Report Resource Website |
RRID:RGD_10054450 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a mutation in the Sirt3 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp deletion in the Sirt3 gene. Contact MCW rat distribution at mcwcustomrats@mcw.edu | 10054450 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2018-10-22) | 10054450 | 2026-02-17 10:58:33 | 0 | |||||
|
SS-Lcatm4Mcwi Resource Report Resource Website |
RRID:RGD_1642366 | Rattus norvegicus | Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. Y336N mutation is generated from the codon change TAT/AAT. | 1642366 | mutant | Rat Genome Database (RGD) | RGD | Extinct (as of 2017-01-26) | 1642366 | 2026-02-17 10:58:39 | 0 | |||||
|
F344-Casp7Tn(sb-T2/Bart3)2.280Mcwi Resource Report Resource Website |
RRID:RGD_2302656 | Rattus norvegicus | These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Casp7 gene. | 2302656 | mutant | Rat Genome Database (RGD) | RGD | Extinct (as of 2017-01-26) | 2302656 | 2026-02-17 10:58:40 | 0 | |||||
|
BRAT-Avpdi/BluHsd Resource Report Resource Website |
RRID:RGD_2314655 | Rattus norvegicus | Hereditary hypothalamic diabetes insipidus was first described in offspring from a Long-Evans stock of rats by Dr. Schroeder, later named Brattleboro strain. In 1964 from Dr. Lewis Kinder, Harvard University, Boston to Blue Spruce Farms, Altamont, New York. to Harlan through acquisition in 1988. Harlan | 2314655 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Embryo; Cryopreserved Sperm (as of 2018-06-21) | 2314655 | 2026-02-17 10:58:43 | 0 | |||||
|
F344-PtpreTn(sb-T2/Bart3)236Mcwi Resource Report Resource Website |
RRID:RGD_2299146 | Rattus norvegicus | These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Ptpre gene. | 2299146 | mutant | Rat Genome Database (RGD) | RGD | Extinct (as of 2017-01-26) | 2299146 | 2026-02-17 10:58:40 | 0 | |||||
|
F344-Scn1am1Kyo Resource Report Resource Website |
RRID:RGD_2306042 | Rattus norvegicus | Established by ENU mutagenesis. A missense mutant N1417H (4246A>G)was identified in the model. National BioResource Project for the Rat in Japan | 2306042 | mutant | Rat Genome Database (RGD) | RGD | Live Animals; Cryopreserved Sperm (as of 2017-05-04) | 2306042 | 2026-02-17 10:58:41 | 0 | |||||
|
F344-Rprd1aTn(sb-T2/Bart3)2.247Mcwi Resource Report Resource Website |
RRID:RGD_2299145 | Rattus norvegicus | These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Rprd1a gene. | 2299145 | mutant | Rat Genome Database (RGD) | RGD | Extinct (as of 2017-01-26) | 2299145 | 2026-02-17 10:58:40 | 0 | |||||
|
F344-Inpp4bTn(sb-T2/Bart3)2.232Mcwi Resource Report Resource Website |
RRID:RGD_2299142 | Rattus norvegicus | These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Inpp4b gene. | 2299142 | mutant | Rat Genome Database (RGD) | RGD | Extinct (as of 2017-01-26) | 2299142 | 2026-02-17 10:58:40 | 0 | |||||
|
F344-Apcm1Kyo Resource Report Resource Website |
RRID:RGD_2306036 | Rattus norvegicus | F344/NSlc rats that have an induced mutation in the Apc (S2523X) gene; Established by ENU mutagenesis (gene-driven). National BioResource Project for the Rat in Japan | 2306036 | mutant | Rat Genome Database (RGD) | RGD | Live Animals; Cryopreserved Sperm (as of 2017-03-14) | 2306036 | 2026-02-17 10:58:42 | 0 | |||||
|
F344-Eva1aTn(sb-T2/Bart3)2.233Mcwi Resource Report Resource Website |
RRID:RGD_2299127 | Rattus norvegicus | These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Eva1a gene. | 2299127 | mutant | Rat Genome Database (RGD) | RGD | Extinct (as of 2017-01-26) | 2299127 | 2026-02-17 10:58:40 | 0 | |||||
|
F344-RGD1564304Tn(sb-T2/Bart3)2.201Mcwi Resource Report Resource Website |
RRID:RGD_2292454 | Rattus norvegicus | These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the RGD1564304 gene. | 2292454 | mutant | Rat Genome Database (RGD) | RGD | Extinct (as of 2017-01-26) | 2292454 | 2026-02-17 10:58:39 | 0 | |||||
|
F344-Lrrc4cTn(sb-T2/Bart3)2.224Mcwi Resource Report Resource Website |
RRID:RGD_2299129 | Rattus norvegicus | These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Lrrc4c gene. | 2299129 | mutant | Rat Genome Database (RGD) | RGD | Extinct (as of 2017-01-26) | 2299129 | 2026-02-17 10:58:40 | 0 | |||||
|
SS-Renem1Mcwi Resource Report Resource Website |
RRID:RGD_4139880 | Rattus norvegicus | This strain was produced by injecting ZFNs targeting the sequence acccttcatgctggccaagtttgacggggttctgggcatg into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 5. | 4139880 | mutant | Rat Genome Database (RGD) | RGD | Live Animals; Cryopreserved Sperm (as of 2017-01-26) | 4139880 | 2026-02-17 10:58:43 | 0 | |||||
|
F344-Tmco1Tn(sb-T2/Bart3)2.135Mcwi Resource Report Resource Website |
RRID:RGD_2290161 | Rattus norvegicus | These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Tmco1 gene. | 2290161 | mutant | Rat Genome Database (RGD) | RGD | Extinct (as of 2017-01-30) | 2290161 | 2026-02-17 10:58:39 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
