Organisms   Select Another Resource Report Type

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=405855877

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Notes: This is the wild type littermate from crossing of heterozygous mutant female rats with wild-type male rats to generate hemizygous null male rats and wild type mutant. Foxo4 mutant strain (RGD:405855876) was created in zygotes from Holtzman Sprague-Dawley. Guided RNAs targeting exon 2 (target sequence: CCAGATATACGAATGGATGGTCC; nucleotides 517-539) and exon 3 (target sequence: GTTCATCAAGGTACATAACGAGG; nucleotides 631-653) of the Foxo4 gene (NM_001106943.1)) were injected to the embryos to create a 3096-bp deletion including the 3' part of exon 2 and 5' part of exon 3, and resulting a premature stop of the protein.

Proper citation: RRID:RGD_405855877 Copy   

•   Source: Integrated Animals

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=616336063

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Notes: This rat strain with neuronal specific knock out of Mt-co3 was generated by crossing a rat neuron-specific Cre strain (NeuN-Cre) with SD-ROSA26 em1(CAG-loxP-stop-loxP-DdCBE-Mt-co3/Ilas. Compared with the controls, the neuron-specific Mt-co3 knock out rats were largely normal in the first postnatal month, but progressively developed ALS-like symptoms afterward. Rat Resource Center of China (www.ratresource.com)

Proper citation: RRID:RGD_616336063 Copy   

•   Source: Integrated Animals

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=616335894

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Notes: The knock in of "CAG-loxP-stop-loxP-DdCBE-Mt-co3" to ROSA26 was induced by CRISPR/Cas9 in SD embryos from Vital River. This ROSA 26 knock in construct carrying DddA-derived cytosine base editor (DdCBE)linked to Mt-co3 was used to introduce premature stop codons in the rat Mt-co3 in mitochondrial genome in the presence of Cre recombinase. Rat Resource Center of China (www.ratresource.com)

Proper citation: RRID:RGD_616335894 Copy   

•   Source: Integrated Animals

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=405849381

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Notes: This Tti2 knockout rats were generated by microinjecting fertilized ova of SHR/OlaIpcv rats with the ZFN (Zinc Finger Nuclease) construct from Sigma-Aldrich. The construct was designed to target the first exon using the following sequence of ZFN binding (capital letters) and cutting site (small letters): TCTGACCCGGATCCAAGCaccaagGGTGGGTGGCAGGGC. DNA samples isolated from 452 rats born after microinjection with ZFN construct were amplified using primers flanking the target sequence: ZFN F: 5'-TACACTGTGATTGGCTGGGA-3' and ZFN R: 5'-GGCGCAGTGGAGTGATC-3'. SHR-Tti2+/- with an 8 bp deletion (NM_001013883.1(Tti2):c.243_250delCGAGATCC; on the protein level: NP_001013905.1:p.Glu82Glyfs) has been selected for further analyses. The heterozygous founder was crossed with SHR and F1 rats were intercrossed. SHR-Tti2+/- heterozygotes were selected for breeding and phenotyping while their wild type littermates were used as controls.

Proper citation: RRID:RGD_405849381 Copy   

•   Source: Integrated Animals

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=597538479

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Notes: The first tish animals were identified on the basis of postmortem histological analyses during the course of unrelated experiments using a strain of Sprague Dawley rats maintained at the University of Virginia. It is called tish (telencephalic internal structural heterotopia) rat. The brain of this mutant animal exhibits a large region of heterotopic gray matter that is located bilaterally beneath the neocortex. Mild to moderate ventriculomegaly is also observed in most tish animals. A breeding colony was established by identifying living relatives of deceased tish individuals, and then these relatives were screened using magnetic resonance imaging (MRI). The tish is identified recessive to wild type by breeding. The mutation was identified as a 1215 bp deletion in the unannotated exon 1 of Eml1 genome (Rnor_6.0; ENSRNOG00000043143). University of Virginia, Charlottesville, VA, United States

Proper citation: RRID:RGD_597538479 Copy   

•   Source: Integrated Animals

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=407450413

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Notes: The Il6 knockout (KO) rats were generated using the CRISPR/Cas9 technique to induce a shift in the reading frame of the second exon of Il6 by KAC Co. Ltd (Kyoto, Japan). This strain carried a 118 bp deleted in the second exon of IL-6 National Cerebral and Cardiovascular Center Research Institute, Suita, Osaka 564-8565, Japan

Proper citation: RRID:RGD_407450413 Copy   

•   Source: Integrated Animals

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=401976372

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Notes: CRISPR/Cas9 technology was used to insert an IRES for Cre expression after the corticotropin-releasing hormone (Crh) gene and is expressed in cells that produce CRH.

Proper citation: RRID:RGD_401976372 Copy   

•   Source: Integrated Animals

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=629006641

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Notes: CRISPR/Cas9 system was used to generate rats with a deletion of the CRE site (Del_TGACGTCA) in the Per1 gene promoter Per1 gene in Sprague Dawley (Charles River) rat embryos. National Institute on Drug Dependence and Beijing Key Laboratory on Drug Dependence Research, Peking University, Beijing, China

Proper citation: RRID:RGD_629006641 Copy   

•   Source: Integrated Animals

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=630350396

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Notes: Deletion of exons 45 to 47 of the rat Dmd gene by CRISPR/Cas9 was performed by using two pairs of sgRNAs on both sides of exons 45 and 47. The spCas9 and sgRNAs were electroporated in rat Sprague Dawley (RjHan:SD) fertilized oocytes. Genotyping PCR and sequencing were used to confirm the deletion of exons 45–47 in F0 founder animals. Rats can be obtained through material transfer agreement by contacting the corresponding author at valentina.- taglietti@inserm.fr and frederic.relaix@inserm.fr.

Proper citation: RRID:RGD_630350396 Copy   

•   Source: Integrated Animals

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=632518356

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Notes: DBH-Cre knock-in (KI) rats, developed on the Sprague Dawley (SD) rat background, were generated using the CRISPR/Cas9 system. In this knock-in model, a gene cassette encod- ing 2A peptide, fused to Cre recombinase was introduced to replace the TAA stop codon in exon 12 of the rat Dbh gene. Additionally, a synonymous mutation p. T616= (ACG to ACA) was incorporated to pre- vent gRNA binding and recutting of the sequence following homology-directed repair. The gRNA targeting the rat DBH gene (gRNA-B1: 5′-TTACTCAGTGTCTGCCTCCGTGG-3′), the donor vector con- taining the “P2A-Cre” cassette, and a synonymous mutation p. T616= (ACG to ACA), along with Cas9 mRNA, were co-injected into fertilized rat embryos. F0 founders. DBH-Cre KI rats were bred with wild-type SD rats (Guangdong Vital River Laboratory Animal Technology Co., Ltd., China). Shenzhen Institute of Advanced Technolog, Shenzhen, China

Proper citation: RRID:RGD_632518356 Copy   

•   Source: Integrated Animals

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=631721277

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Notes: The mutant rats were generated using CRISPR/Cas9 technology to target upstream of exon 11 or downstream of exon 21 of rat Shank3. The resulting mutant carried approximately 26 kb deletions with the removal of the Shank3 exon 11–21 zhangrong@bjmu.edu.cn at Department of Neurobiology, School of Basic Medical Sciences, Peking University, Beijing, China

Proper citation: RRID:RGD_631721277 Copy   

•   Source: Integrated Animals

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=629142769

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Notes: The is the wild type litter mate for the Dmd mutant: CD-Dmdem1Gene (RGD:629142768), Genethon; 1, bis rue de l’internationale23 91000 Evry, France

Proper citation: RRID:RGD_629142769 Copy   

•   Source: Integrated Animals

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=629142768

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Notes: The model was generated using a single guide RNA-Cas9 targeted to exon 45 of the rat Dmd gene on a Sprague-Dawley (CD®(SD), Crl:CD(SD)) background. One male founder with a 606 bp deletion encompassing Dmd exon 45 and spanning from 207 bp into the 3’ region of intron 44 to 223 bp into the 5’ region of intron 45,including exon 45, was selected for phenotyping. The heterozygous/hemizygous Dmd knock-out lines were used for breeding. Genethon; 1, bis rue de l’internationale23 91000 Evry, France

Proper citation: RRID:RGD_629142768 Copy   

•   Source: Integrated Animals

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=616390066

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Notes: To generate the 5p15.2 deletion in the rat, two CRISPR gRNAs were designed at syntenic loci in the rat genome: ATGTCGATGTCTTGTTAGGGTGG at Chr.2:83120000 (RGSC 6.0/rn6) and GCTGAGATGGCTTTCAGAAATGG at Chr.2:84800000 (RGSC 6.0/rn6), which induced ≈1.68 Mb chromosomal deletion. The Biocytogen Transgenic and Gene Targeting core injected 50 ng uL−1 of each gRNAs and 100 ng uL−1 Cas9 RNA into single‐cell SD rat zygotes. Embryos were cultured overnight and transferred to pseudopregnant females. PCR was used to screen for the deletion. PCR was performed using genomic ear or tail DNA, and the following primer pair: Proximal Forward‐TTGCTCAGCTGTTAAGGGAAACTAT and Distal Reverse‐TCATCAAAATGCACCAAAAGTGCAA (these primers generate ≈485 bp product). PCR primers were used to detect the breakpoint on the undeleted 5p15.2 interval (wild‐type allele): Proximal Forward‐TTGCTCAGCTGTTAAGGGAAACTAT and Proximal Reverse‐GGAGTAAGTCAACTGACTAGGGGACA (these primers generate ≈618 bp product).

Proper citation: RRID:RGD_616390066 Copy   

•   Source: Integrated Animals

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=629020173

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Notes: The Cre recombinase gene was knocked into exon 2 of the Drd2 gene using CRISPR/Cas9 genome editing. RRRC:00979

Proper citation: RRID:RGD_629020173 Copy   

•   Source: Integrated Animals

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=405100723

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Notes: The CRISPR/Case9 knock-in of CAG-LSL-Ghsr (LSL: loxp-Stop-Loxp) to the ROSA 26 locus of LE rats has cre recombinase-dependent expression of rat Ghsr under the control of CAG promoter. ROSA26 is a synonym for rat Thumpd3-as1 (RGD:6491660) and is used as an official symbol for rat strain nomenclature.

Proper citation: RRID:RGD_405100723 Copy   

•   Source: Integrated Animals

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=152999023

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Notes: Applied StemCell, Inc (Milpitas, CA) was contracted to generate the Iba1-EGFP knock-in rat model using CRISPR/Cas9 technology in the Sprague Dawley rat strain. The donor construct inserted consisted of the EGFP coding sequence (minus the first ATG), followed by the 22 amino acid sequence of the porcine teschovirus-1 2A (P2A) self-cleaving peptide, and then the first exon of the rat Iba1 gene immediately downstream of the translational start site. Guide RNA with the following sequence: 5'- TACCCTGCAAATCCTTGCTCTGG-3' targeting the Iba1 gene just downstream of the translational start site were used.

Proper citation: RRID:RGD_152999023 Copy   

•   Source: Integrated Animals

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=629464

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Notes: This fatty zucker is derived from Lois and Theodore Zucker colonies from which Research colonies were established at many institutions.

Proper citation: RRID:RGD_629464 Copy   

•   Source: Integrated Animals

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=629463

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Notes: This is the littermate of ZUC-LeprfaSte-/-. The fa mutation occurred spontaneously in the 13M stock and was reported by Lois Zucker and Theodore Zucker in 1960. This was observed during genetic experiments related to coat color and body size. These rats have lean phenotype.

Proper citation: RRID:RGD_629463 Copy   

•   Source: Integrated Animals

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10045582

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Embryo; Cryopreserved Sperm
References:
Synonyms:
Notes: This strain shows malocclusion. National BioResource Project for the Rat in Japan

Proper citation: RRID:RGD_10045582 Copy   

•   Source: Integrated Animals