Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=12790662
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2021-11-03)
References:
Synonyms:
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Mb gene of WKY/NCrl rat embryos. The resulting mutation is a 25-bp deletion in the exon 2 of the Mb gene. Contact MCW rat distribution at mcwcustomrats@mcw.edu
Proper citation: RRID:RGD_12790662 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=12790944
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2021-11-03)
References:
Synonyms:
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Sik2 gene of WKY/NCrl rat embryos. The resulting mutation is a 5-bp deletion in exon 4 of the Sik2 gene. Contact MCW rat distribution at mcwcustomrats@mcw.edu
Proper citation: RRID:RGD_12790944 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=13628730
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Notes: TALEN targeting the 2nd exon of rat Il2rg gene was designed and mRNA coding these TALEN was microinjected into Crl:SD embyo.This strain carrying an 80 bp deletion generated a premature stop codon in the 3rd exon. No Il2rg protein was detected by western blot.
Proper citation: RRID:RGD_13628730 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=12880026
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Embryo (as of 2017-05-01)
References:
Synonyms:
Notes: This rat model carries a bi-allelic deletion of the amyloid precursor protein (APP) gene. Horizon Discovery
Proper citation: RRID:RGD_12880026 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=13207509
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm; Cryorecovery (as of 2021-11-03)
References:
Synonyms:
Notes: CRISPR/Cas9 system was used to introduce a mutation in the P2rx1 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp deletion in Exon 2 of the P2rx1 gene. Contact MCW rat distribution at mcwcustomrats@mcw.edu
Proper citation: RRID:RGD_13207509 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=12905036
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Live Animals (as of 2017-05-31)
References:
Synonyms:
Notes: This model expresses cre-recombinase under the control of the endogenous 5 prime-hydroxytryptamine receptor 3A (5Ht3a) promoter enabling specific expression in 5Ht3a positive serotonergic neurons. This model possesses a targeted insertion of (T2A)-cre immediately before the translational stop in the open reading frame of the 5Ht3a gene. The 5Ht3a-Cre rat is useful for applications requiring tissue specific expression, including optogenetics and breeding with transgenic floxed lines. Horizon Discovery
Proper citation: RRID:RGD_12905036 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=12904903
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Live Animals (as of 2017-05-24)
References:
Synonyms:
Notes: This ZFN model carries a 2 bp deletion within exon 3 of the Rag2 gene on chromosome 3. Homozygous Rag2 knockout rats display loss of RAG2 protein via Western blot. Homozygous Rag2 knockout rats show loss of B and T cells by FACS analysis. Horizon Discovery
Proper citation: RRID:RGD_12904903 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=12904902
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Embryo (as of 2017-05-24)
References:
Synonyms:
Notes: This ZFN model carries a 29 bp deletion within exon 2 of the Rag1 gene on chromosome 3. Rag1 knockout rats lack mature B and T lymphocytes. Horizon Discovery
Proper citation: RRID:RGD_12904902 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=11553908
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2021-11-03)
References:
Synonyms:
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Trpc6 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 3-bp substitutions to generate P112Q in Exon 2 of the Trpc6 gene. Contact MCW rat distribution at mcwcustomrats@mcw.edu
Proper citation: RRID:RGD_11553908 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=12904733
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Embryo (as of 2017-05-19)
References:
Synonyms:
Notes: This ZFN induced knockout model contains 11 bp bi-allelic deletion within exon 1 of the Slc22a1. The homozygous knockout rats display total loss of protein via Western blot. Horizon Discovery
Proper citation: RRID:RGD_12904733 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=13207529
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2021-11-03)
References:
Synonyms:
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Spp1 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 5-bp deletion in Exon 3 of the Spp1 gene. Contact MCW rat distribution at mcwcustomrats@mcw.edu
Proper citation: RRID:RGD_13207529 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=12902621
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Live Animals (as of 2017-06-20)
References:
Synonyms:
Notes: This ZFN model contains a monoallelic deletion of the Bdnf gene, encoding for the nerve growth factor protein BDNF. Homozygous animals carrying the Bdnf deletion are postnatal lethal. Reductions of BDNF have been observed in patients with Alzheimer's disease (AD), and this model may be useful for understanding the role of BDNF in AD. Horizon Discovery
Proper citation: RRID:RGD_12902621 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=12902625
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Live Animals (as of 2017-05-09)
References:
Synonyms:
Notes: This ZFN model contains a 20-bp deletion within the Nr1i2 gene. No induction of Cyp3a1 in the model. Horizon Discovery
Proper citation: RRID:RGD_12902625 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=12902616
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Live Animals (as of 2017-05-09)
References:
Synonyms:
Notes: These rats were created using CrISPR/Cas9 system to replace the Rat ApoE gene with the Human 4 allele APOE gene Horizon Discovery
Proper citation: RRID:RGD_12902616 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=13207513
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryorecovery (as of 2017-08-03)
References:
Synonyms:
Notes: This is compound transgenic/mutant rat strain derived from the breeding of SS-Tg(Slc12a1-Ncf2-2A-Luc) and SS-Ncf2em1Mcwi. Contact MCW rat distribution at mcwcustomrats@mcw.edu
Proper citation: RRID:RGD_13207513 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=13208842
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2021-11-03)
References:
Synonyms:
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Ptgs2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 53-bp deletion of exon 4 in the Ptgs2 gene. Contact MCW rat distribution at mcwcustomrats@mcw.edu
Proper citation: RRID:RGD_13208842 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=13437612
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Notes: This strain was produced by injecting ZFNs target sequence CCGCGGTTGCTTTGCGCTCTGGGTGCTGTTGCTGGCGCA into Dahl S rat eggs as . The resulting mutation is a 17-bp deletion of the sequence gctctgggtgctgttgc in exon 1.
Proper citation: RRID:RGD_13437612 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=13207595
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2021-11-03)
References:
Synonyms:
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Tph1 gene of WKY/NCrl rat embryos. The resulting mutation is a 1-bp deletion in the exon 4 of the Tph1 gene. Contact MCW rat distribution at mcwcustomrats@mcw.edu
Proper citation: RRID:RGD_13207595 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=13207518
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryorecovery (as of 2018-05-01)
References:
Synonyms:
Notes: CRISPR/SpCas9 was used to create indel mutations in Hspa1a, Hspa1b, Hspa1L in SHR/NCrl embryos. Contact MCW rat distribution at mcwcustomrats@mcw.edu
Proper citation: RRID:RGD_13207518 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=13207514
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Live Animals (as of 2017-08-03)
References:
Synonyms:
Notes: CRISPR/SpCas9 was used to knock in the Epac-SH187, Epac-based FRET sensor into the Rosa26 locus under the control of the endogenous promoter using an Ad2 splice acceptor. Contact MCW rat distribution at mcwcustomrats@mcw.edu
Proper citation: RRID:RGD_13207514 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
