Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=149735338
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Notes: Rat Wfs1 exon 5-specific zinc-finger nucleases (ZNFs) and microinjection-ready mRNA were injected to embryos harvested from female Sprague-Dawley rats (Crl: CD(SD) )rats. Thereafter, microinjected egg cells were transferred to the oviduct of pseudopregnant Sprague-Dawley recipients.Three different Wfs1 mutant rat lines were created: Wfs1em1 ( Wfs1-ex5-KO232), Wfs1em2 (Wfs1-ex5-KO266) and Wfs1em3 (Wfs1-ex5-INS244). Wfs1em3 rats carry a substitution in exon 5 of the Wfs1 gene, which is predicted to result in a substitution of LQK (aa 224-226)
into YCMNTI in the WFS1 protein.
Proper citation: RRID:RGD_149735338 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=150429598
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Notes: The rat strain was created via CRISPR/Cas9 targeting the VWF gene in DahlSS/Mcw (SS/JrHsdMcwi ) rat embryos. The resulting rat strain has a 13bp deletion in the untranslated region of Exon 52 of the VWF gene (g.158491511 - 158491523 on chromosome 4, Assembly: mRatBN7.2) The 13-bp deletion happens to be in the region where the polyadenylation signal resides (AAUAAA). The resulting mRNA is not polyadenylated and has trouble with transport from the nucleus to the cytoplasm. The result is a phenotype that is similar to a Type I von Willebrand Disease, being a partial quantitative deficiency of the circulating VWF protein. Some mRNA must make it through to translation, because low levels of VWF protein are detectable via ELISA (<10%). Both homozygous pairs and heterozygous pairs were used for breeding. Rat Genetic Models, through Versiti Blood Research Institute
Proper citation: RRID:RGD_150429598 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=38501086
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Notes: BMPR2-deficient rats were generated by using zinc-finger nucleases (Sigma, St. Louis, MO). The mRNA encoding mRNA at 5 ng/μL encoding a pair of zinc-finger nucleases recognizing rat BMPR2 sequences was injected to the cytoplasm of Sprague-Dawley zygotes. A rat line with a heterozygous 140 base pairs deletion in the first exon (BMPR2Δ140Ex1/+ rats) was chosen for this study becauseit displayed an intense pulmonary vascular remodeling at 3 months of life that was absent in the wild-type littermates.
Proper citation: RRID:RGD_38501086 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=152999001
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Notes: Exon 4 of the rat Fxn gene was targeted for homologous recombination to introduce loxP sites using CRISPR/Cas9 This strain has been deposited with RRRC.
Proper citation: RRID:RGD_152999001 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=125093746
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Notes: CRISPR/Cas9 system was used to introduce a 371-bp deletion of exon 2 in the rat Disc1 gene of one-cell Crl:SD embryos. This deletion caused non-sense mutation and early termination of translation.
Proper citation: RRID:RGD_125093746 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=150521556
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Notes: Trpm4 gene specific Zinc finger constructs directed against exons 18-19, which
contain the coding sequence for TM3-5 and the pore region of the TRPM4 protein, were injected in zygotes from Sprague-Dawley rats. This mutant rat with a 514 bp deletion which includes completely removes exon 18 and a piece of exon 19 from the Trpm4 gene, plus the intron 18-19. The deletion was confirmed via genomic
sequencing and western blotting.
Proper citation: RRID:RGD_150521556 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=329333019
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Notes: This Spon2 knockout mutant was produced by injecting TALENs targeting exon 2 of rat Spon2 into Sprague Dawley embryos. Founder #4-1 (a1) carrying a 22-bp deletion was chosen to produce heterozygous and homozygous rats.
Proper citation: RRID:RGD_329333019 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=151347605
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Notes: CRISPR-Cas9 technique was used to generate DDAH1-/- rats on Sprague-Dawley background. Genome deletion in exon 1 was confirmed by PCR analysis with the primers:DDAH1-F (5'-GCGCTGCTCTCGGGAAGA-3') and DDAH1-R (5'-GGGTGATGAGGGCGGTCT-3').
Proper citation: RRID:RGD_151347605 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=155791425
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Notes: The IL2Rg gene was targeted in the SS/JrHsdMcwi rat by
TALEN injection into single-cell rat embryos. Once established, a homozygous (RGD:12790632) female rat from the SSIL2Rg line was intercrossed with a homozygous SS.BN3 (RGD:1358154) male to yield heterozygous SS.BN3IL2Rg offspring (F1),
followed by brother-sister mating to yield homozygous SS.
BN3IL2Rg offspring by the F3 generation. This strain is Immunodeficient Ilrg (X-SCID) mutant consomic line.
Proper citation: RRID:RGD_155791425 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=155598601
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Notes: CRISPR/Cas9 system was used to introduce a 58-base pair deletion in exon 6 in the rat Bmal1 gene of Crl:SD embryos. The deletion caused a premature stop codon in exon 6 resulting in a severe truncation of the Bmal1 protein. Contact MCW rat distribution at mcwcustomrats@mcw.edu
Proper citation: RRID:RGD_155598601 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=155631289
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Notes: This mutant strain was generated by microinjecting CRISPRs/Cas9 system targeting rat Pde6b. Pde6b knock out rat was successfully created. Cyagen Biosciences Inc, Santa Clara, CA, USA
Proper citation: RRID:RGD_155631289 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=155630633
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Notes: The mutant rat was produced by injecting Crl:CD(SD) zygotes with gRNA +Cas9 ribonucleoprotein complex targeting exon 3 of rat Ctns. The founder of this strain possessed a 8-bp insertion which results in frameshift and pre-mature stop truncated protein.
Proper citation: RRID:RGD_155630633 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=155631278
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Notes: This mutant strain was generated by electroporating rat zygotes with CRISPRs/Cas9 system targeting exon12 of rat Flna into Crl:SD embryo. This mutant strain carries P637Q knock in the gene.
Proper citation: RRID:RGD_155631278 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=288084580
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Notes: This mutation Phe54Leu is an autosomal dominant mutation that appeared in a stock of F344/NSlc rats that had been mutagenized with N-ethyl-N-nitrosourea (ENU). Rats heterozygous for Txn1 (Txn1 /+) exhibited running seizures only in its juvenile stage. The rat called Adem rat, exhibited age dependent mitochondrial cytopathy (Adem). The rats were backcrossed for more than ten generations on the F344/NSlc inbred background to ensure other mutations induced by ENU was reduced. The causative gene was identified as a missense substitution (c. 160 T > C, p. Phe54Leu) in exon 3 of Txn1.
Proper citation: RRID:RGD_288084580 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=155791440
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Notes: Immunodeficient subcongenic line developed by intercross SS-Chr 3BN.SS-(D3Rat222-D3Rat218).Il2rgem1Mcwi/Mcwi (RGD:155791433) heterozygous congenic, Il2rg null mutant (X-SCID) lines. Contact MCW rat distribution at mcwcustomrats@mcw.edu for availability.
Proper citation: RRID:RGD_155791440 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5688037
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration: (null)
Availability: Unknown
References:
Synonyms:
Notes: ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.
Proper citation: RRID:RGD_5688037 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=405855876
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Notes: This Foxo4 mutant strain was created in zygotes from Holtzman Sprague-Dawley. Guided RNAs targeting exon 2 (target sequence: CCAGATATACGAATGGATGGTCC; nucleotides 517-539) and exon 3 (target sequence: GTTCATCAAGGTACATAACGAGG; nucleotides 631-653) of the Foxo4 gene (NM_001106943.1)) were injected to the embryos to create a 3096-bp deletion including the 3' part of exon 2 and 5' part of exon 3, and resulting a premature stop of the protein.
Proper citation: RRID:RGD_405855876 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=405100226
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Notes: Colony founders were produced by SAGE (Sigma Advanced Genetic Engineering) Labs using ZFN-mediated disruption of Fmr1 with a targeted construct containing coding sequence for eGFP; resulting founders did not express FMRP or eGFP. Simons Initiative for the Developing Brain (SIDB), Institute for Neuroscience and Cardiovascular Research, University of Edinburgh, Edinburgh EH8 9XD, UK. Contact SIDB Scientific Officer for enquiries on rat distribution (sidbadm@ed.ac.uk).
Proper citation: RRID:RGD_405100226 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=155791439
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Notes: Immunodeficient subcongenic line developed by intercross SS-Chr 3BN.SS-(D3Rat222-D3Rat218).Il2rgem1Mcwi/Mcwi (RGD:155791433) heterozygous congenic, Il2rg null mutant (X-SCID) lines. Contact MCW rat distribution at mcwcustomrats@mcw.edu for availability.
Proper citation: RRID:RGD_155791439 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=329849003
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Unknown
References:
Synonyms:
Notes: A complex of Cas9 protein and gRNA was introduced into Iar:LE fertilized rat eggs by electroporation. Combi-CRISPR (Yoshimi K. et al.) was used to induce knock-in. Knock-in rats were selected and crossed with wild-type rats to establish this strain. Sequence features: the intron just before the fourth exon of the Pvalb gene (intron 3) is deleted by NHEJ after double-strand break by one base compared to the wild-type. ---ttggcgggccagaacctcagggg---(wild-type) ---ttggcgggccagaacc-cagggg---(knock-in) National BioResource Project for the Rat in Japan
Proper citation: RRID:RGD_329849003 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
