Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 1 showing 1 ~ 20 out of 178 results
Snippet view Table view Download 178 Result(s)
Click the to add this resource to a Collection
  • RRID:Addgene_11794

http://www.addgene.org/11794

Species:
Genetic Insert: JS200
Vector Backbone Description: Backbone Size:0; Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
References:
Comments: For use with pEP PolI (addgene #11722) and pWT PolI (addgene #11721). This strain contains a temp sens mutation in PolI.

Proper citation: RRID:Addgene_11794 Copy   


  • RRID:Addgene_115926

http://www.addgene.org/115926

Species:
Genetic Insert: none
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
References:
Comments: E. coli K12 MG1655 genotype: F- λ- ilvG- rfb-50 rph-1 Integration at lambda attB: pOSIP-KL-mCherry Integration at primary 186 attB: pOSIP-KO-RBS2-dCas9 mCherry quantifies dCas9 repression

Proper citation: RRID:Addgene_115926 Copy   


  • RRID:Addgene_172602

http://www.addgene.org/172602

Species:
Genetic Insert:
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
References:
Comments: The BW-Para E. coli strain is used to screen the functions of chimeric AraC/XylS transcription activators using beta-galactosidase assays (after growing transformed cells on MOPS media). Plasmids encoding these chimeras are found at https://www.addgene.org/browse/article/28216962/.  The protocol for the reporter assay is detailed in the manuscript. The genotype for BW-Para is [F-, Δ(araD-araB)567, ΔlacZ4787(::rrnB-3), λ-, rph-1, Δ(rhaD-rhaB)568, hsdR514], ΔlacI785::kan, ΔaraC771::kan, ΔrhaSR::(PBADmut:lacZ)].  The PBADmut:lacZ reporter construct integrated into the rhaSR KO locus comprises a synthetic Para-I promoter with -10/-35 sites of GATACT/TTTACA respectively and an ara-I DNA binding site proximal to the -35 site.  The integrated 3.5 kb cassette coding for the reporter construct can be amplified from the genome using the primers: (forward) 5' - GGTGAAAGTTGGAACCTCTTAC - 3' and (reverse) 5'- GCGAGGAAGCGGAATATATCCCC - 3'. Cells should be freshly transformed prior to each assay.

Proper citation: RRID:Addgene_172602 Copy   


  • RRID:Addgene_132780

http://www.addgene.org/132780

Species:
Genetic Insert:
Vector Backbone Description: Vector Backbone:Strain; Vector Types:; Bacterial Resistance:None
References:
Comments: Genotype: W3110 ∆waaL ∆lpxM

Proper citation: RRID:Addgene_132780 Copy   


http://www.addgene.org/188474

Species:
Genetic Insert: P-R-lox-TT-lox-bla
Vector Backbone Description: Vector Backbone:E. coli K-12 MG1655; Vector Types:; Bacterial Resistance:None
References:
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.06.10.495621v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_188474 Copy   


http://www.addgene.org/188475

Species:
Genetic Insert: P-R-lox-TT-lox-knt
Vector Backbone Description: Vector Backbone:E. coli K-12 MG1655; Vector Types:; Bacterial Resistance:None
References:
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.06.10.495621v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_188475 Copy   


http://www.addgene.org/188476

Species:
Genetic Insert: P*-R-lox-TT-lox-knt
Vector Backbone Description: Vector Backbone:E. coli K-12 MG1655; Vector Types:; Bacterial Resistance:None
References:
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.06.10.495621v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_188476 Copy   


  • RRID:Addgene_197934

http://www.addgene.org/197934

Species:
Genetic Insert: RNA polymerase gene (T7 phage)/chromosome
Vector Backbone Description: Vector Backbone:BL21(DE3); Vector Types:; Bacterial Resistance:None
References:
Comments: Genotype: The same as BL21(DE3) except for the additional mutations at 95 UAG codons, disruption of prfA, and frameshift in fabR.

Proper citation: RRID:Addgene_197934 Copy   


  • RRID:Addgene_118727

http://www.addgene.org/118727

Species:
Genetic Insert: none
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
References:
Comments: E. coli K12 MG1655 genotype: F- λ- ilvG- rfb-50 rph-1 Integration at HK022 attB: pOSIP-KH-RBS2-dCas9

Proper citation: RRID:Addgene_118727 Copy   


  • RRID:Addgene_134836

http://www.addgene.org/134836

Species:
Genetic Insert: lysogen of a temperature-inducible bacteriophage lambda
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
References:
Comments: Genotype is [λ+ Lac- galK2 IN(rrnD-rrnE)1 rph-1], a derivative of strain W3102 Phenotypic assay: Grow at 30°C, but restricted at 42°C due to the induction of phage particles and cell lysis.

Proper citation: RRID:Addgene_134836 Copy   


  • RRID:Addgene_141407

http://www.addgene.org/141407

Species:
Genetic Insert:
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
References:
Comments: λ- F- glnX44 e14- (McrA-) rfbD1 endA1 thi-1 Δ(yjiT-opgB)114::IS10 (EcoKI R- M- McrBC- Mrr-) + rpoS393(am) creC510 lrhA::IS3 ydeN::IS10 ΔlacI Verification of lacI deletion: PCR reaction on genomic DNA using AK362 and AK365 primers produces a 1936 bp fragment AK 362 5’-CAATACCAATCGCACGCGG AK 365 5’-CGAGACGTCACGGAAAATGCC Phenotype: Constitutive β-galactosidase synthesis This strain was derived from the precursor strain, E. coli ER1821, which is described in Jobling et al. (2016) Complete Genome Sequence of Escherichia coli ER1821R, a Laboratory K-12 Derivative Engineered To Be Deficient in All Methylcytosine and Methyladenine Restriction Systems. Genome Announc 4(4):e00763-16. https://www.ncbi.nlm.nih.gov/pubmed/27516504

Proper citation: RRID:Addgene_141407 Copy   


  • RRID:Addgene_119737

http://www.addgene.org/119737

Species:
Genetic Insert:
Vector Backbone Description: Vector Backbone:See supplemental files for plasmid details; Vector Types:; Bacterial Resistance:None
References:
Comments: Strain can be grown on LB without antibiotics. Resistant to: ampicillin, chloramphenicol, florfenicol, gentamicin, kanamycin, nalidixic acid, streptomycin, spectinomycin, sulphonamides, tobramycin, tetracycline, trimethoprim Please note that plasmids are stable in the absence of antibiotic selection. 39R861+ is resistant to nalidixic acid due to a chromosomal mutation. The remaining resistance determinants are plasmid-borne. 39R861+ contains six plasmids, outlined in the supplemental files.

Proper citation: RRID:Addgene_119737 Copy   


  • RRID:Addgene_72402

http://www.addgene.org/72402

Species:
Genetic Insert:
Vector Backbone Description: Vector Backbone:E. coli BW25113; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:None
References:
Comments: No antibiotic resistance.

Proper citation: RRID:Addgene_72402 Copy   


  • RRID:Addgene_67755

http://www.addgene.org/67755

Species:
Genetic Insert: none
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
References:
Comments: The genotype of the strain relative to MG1655 is complex, since there are many single nucleotide variations and several 10-20kb differences (Brown & Jun (2015) Genome Announcements, Lyons et. al. (2011) PLoS ONE). There are a particular abundance of differences in the rDNA operons, which in several cases align more closely to E. coli strains DH10B, MDS42, and W. Particularly relevant genotypes are: λ+ gal+ eut+ pyrE+ ilvG+ rpoS33Am glnV(SupAm) evgA::IS1 Δrfb

Proper citation: RRID:Addgene_67755 Copy   


  • RRID:Addgene_65915

http://www.addgene.org/65915

Species:
Genetic Insert: MG1655 Z1 malE
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
References:
Comments: F-, lambda-, rph-1, laciq, PN25-tetR, SpR, malE-

Proper citation: RRID:Addgene_65915 Copy   


  • RRID:Addgene_78552

http://www.addgene.org/78552

Species:
Genetic Insert: pTet--Cas9 cassette integrated at 186 primary attB site
Vector Backbone Description: Vector Backbone:na; Vector Types:; Bacterial Resistance:None
References:
Comments:

Proper citation: RRID:Addgene_78552 Copy   


  • RRID:Addgene_62820

http://www.addgene.org/62820

Species:
Genetic Insert: see comments
Vector Backbone Description: Vector Backbone:N/A; Vector Types:Synthetic Biology; Bacterial Resistance:None
References:
Comments: MG1655 + lacIq intergrated at intS + ΔglmZ + Dhfq

Proper citation: RRID:Addgene_62820 Copy   


  • RRID:Addgene_63667

http://www.addgene.org/63667

Species:
Genetic Insert: see comments
Vector Backbone Description: Vector Backbone:N/A; Vector Types:Synthetic Biology; Bacterial Resistance:None
References:
Comments: MG1655 + lacIq intergrated at intS + ΔglmZ

Proper citation: RRID:Addgene_63667 Copy   


  • RRID:Addgene_34929

http://www.addgene.org/34929

Species:
Genetic Insert:
Vector Backbone Description: Vector Backbone:None; Vector Types:; Bacterial Resistance:None
References:
Comments: To prevent possible enzymatic dephosphorylation of O-phospho-L-serine (Sep) in vivo, the gene encoding phosphoserine phosphatase (serB), which catalyzes the last step in serine biosynthesis, was deleted from Escherichia coli strain BL21. Markerless gene deletions were carried out using a λ-red and FLP recombinase-based gene knockout strategy.

Proper citation: RRID:Addgene_34929 Copy   


  • RRID:Addgene_35609

http://www.addgene.org/35609

Species:
Genetic Insert: none
Vector Backbone Description: Vector Backbone:NA; Vector Types:; Bacterial Resistance:None
References:
Comments: To be used with the following plasmids from the Matthews lab: pTARA (www.addgene.org/31491), pLS1 (www.addgene.org/31490), and (www.addgene.org/31492) pLS1/-11

Proper citation: RRID:Addgene_35609 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. Neuroscience Information Framework Resources

    Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within NIF that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X