Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pAW216 Resource Report Resource Website |
RRID:Addgene_113238 | Cas1 | Other | Streptomycin | PMID:28729350 | Backbone Size:4000; Vector Backbone:pCDF1b; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin | 2022-04-22 03:18:15 | 0 | ||
|
pAW156 Resource Report Resource Website |
RRID:Addgene_113185 | Cas1 | Other | Streptomycin | PMID:28729350 | Backbone Size:4000; Vector Backbone:pCDF1b; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin | K259E | 2022-04-22 03:18:14 | 0 | |
|
pAW210 Resource Report Resource Website |
RRID:Addgene_113189 | Cas1 | Other | Streptomycin | PMID:28729350 | Backbone Size:4000; Vector Backbone:pCDF1b; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin | H208A | 2022-04-22 03:18:14 | 0 | |
|
pAW188 Resource Report Resource Website |
RRID:Addgene_113178 | Cas1 | Other | Streptomycin | PMID:28729350 | Backbone Size:4000; Vector Backbone:pCDF1b; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin | R131A | 2022-04-22 03:18:14 | 0 | |
|
pAW158 Resource Report Resource Website |
RRID:Addgene_113177 | Cas1 | Other | Streptomycin | PMID:28729350 | Backbone Size:4000; Vector Backbone:pCDF1b; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin | R112E | 2022-04-22 03:18:14 | 0 | |
|
pAW152 Resource Report Resource Website |
RRID:Addgene_113175 | Cas1 | Other | Streptomycin | PMID:28729350 | Backbone Size:4000; Vector Backbone:pCDF1b; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin | K12E | 2022-04-22 03:18:14 | 0 | |
|
pAW185 Resource Report Resource Website |
RRID:Addgene_113179 | Cas1 | Other | Streptomycin | PMID:28729350 | Backbone Size:4000; Vector Backbone:pCDF1b; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin | R132A | 2022-04-22 03:18:14 | 0 | |
|
pAW189 Resource Report Resource Website |
RRID:Addgene_113180 | Cas1 | Other | Streptomycin | PMID:28729350 | Backbone Size:4000; Vector Backbone:pCDF1b; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin | Q136A | 2022-04-22 03:18:14 | 0 | |
|
pBS_24x-601_MA1+MA3 Resource Report Resource Website |
RRID:Addgene_114362 | 24X601-MA1_2 | Synthetic | Streptomycin | PMID:30455303 | Vector Backbone:pENTR223; Vector Types:Mammalian Expression, Unspecified; Bacterial Resistance:Streptomycin | 2022-04-22 03:18:37 | 0 | ||
|
pBS_24x-601_MA1+MA2 Resource Report Resource Website |
RRID:Addgene_114361 | 24X601-MA1_2 | Synthetic | Streptomycin | PMID:30455303 | Vector Backbone:pBS; Vector Types:Mammalian Expression, Unspecified; Bacterial Resistance:Streptomycin | 2022-04-22 03:18:37 | 0 | ||
|
pBS_12x-601_MA2 Resource Report Resource Website |
RRID:Addgene_114359 | 12X601-MA2 | Synthetic | Streptomycin | PMID:30455303 | Vector Backbone:pBS; Vector Types:Mammalian Expression, Unspecified; Bacterial Resistance:Streptomycin | 2022-04-22 03:18:37 | 0 | ||
|
pSG020 Resource Report Resource Website |
RRID:Addgene_126503 | disaggregase ClpGgi with 6xHis-tag | Other | Streptomycin | PMID:29263094 | conditional Biosafety Level 2 if expressed in Pseudomonas aeruginosa SG17M | Backbone Size:6055; Vector Backbone:pJN105; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin | 2022-04-22 03:22:26 | 0 | |
|
pYI048 Resource Report Resource Website |
RRID:Addgene_170844 | pGH3.17::SMT2-FLAG | Streptomycin | PMID:36216814 | Please visit https://doi.org/10.1101/2021.06.16.448628 for bioRxiv preprint. | Vector Backbone:pYI001; Vector Types:Plant Expression; Bacterial Resistance:Streptomycin | 2022-10-15 01:02:15 | 0 | ||
|
pYI046 Resource Report Resource Website |
RRID:Addgene_170842 | pUBQ10::SMT2-FLAG::tOCS | Streptomycin | PMID:36216814 | Please visit https://doi.org/10.1101/2021.06.16.448628 for bioRxiv preprint. | Vector Backbone:pFP100; Vector Types:Plant Expression; Bacterial Resistance:Streptomycin | 2022-10-15 01:02:15 | 0 | ||
|
pYI047 Resource Report Resource Website |
RRID:Addgene_170843 | pFRO6::SMT2-FLAG | Streptomycin | PMID:36216814 | Please note that the Addgene verified sequence differs from the depositor reference sequence linked in the supplemental documents section. These differences did not impact plasmid function. The primers 5' - ATCCAAGCTCAAGCTAAGCTcgatgctctcaaggccaa and 3' -TATCTCATTAAAGCAGGATCCTCACTTGTCATCGTCGTCCTTGTAATCAGAACTCTCCTCCGGT were previously used, although the 5' primer differs slightly from the Addgene verified sequence. Please visit https://doi.org/10.1101/2021.06.16.448628 for bioRxiv preprint. | Vector Backbone:pYI001; Vector Types:Plant Expression; Bacterial Resistance:Streptomycin | 2022-10-15 01:02:15 | 0 | ||
|
pYI012 Resource Report Resource Website |
RRID:Addgene_170841 | GH3.17p | Streptomycin | PMID:36216814 | Please visit https://doi.org/10.1101/2021.06.16.448628 for bioRxiv preprint. | Vector Backbone:pYI001; Vector Types:Plant Expression; Bacterial Resistance:Streptomycin | 2022-10-15 01:15:54 | 0 | ||
|
pSUMO2 Resource Report Resource Website |
RRID:Addgene_52259 | SUMO-2 | Homo sapiens | Streptomycin | PMID:25007328 | Backbone Marker:Novagen; Backbone Size:3781; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin | C-terminal gly-gly | 2022-11-11 12:04:33 | 0 | |
|
pSUMO3 Resource Report Resource Website |
RRID:Addgene_52260 | SUMO-3 | Homo sapiens | Streptomycin | PMID:25007328 | Backbone Marker:Novagen; Backbone Size:3781; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin | C-terminal gly-gly | 2022-11-11 12:16:15 | 0 | |
|
pSA2 Resource Report Resource Website |
RRID:Addgene_52262 | SUMO-2 | Homo sapiens | Streptomycin | PMID:25007328 | Backbone Marker:Novagen; Backbone Size:3781; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin | C-terminal gly-gly | 2022-11-11 12:04:33 | 0 | |
|
pWUR790 Resource Report Resource Website |
RRID:Addgene_101723 | PfAgo | Other | Streptomycin | PMID:25925567 | Backbone Marker:Novagen; Backbone Size:3621; Vector Backbone:pCDF-1b; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin | 2022-04-22 03:15:08 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
