Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Gallus gallus
Genetic Insert: c-src Y416F
Vector Backbone Description: Backbone Size:6400; Vector Backbone:pEVX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: Based on plasmid pM5HHB5.
Proper citation: RRID:Addgene_17676 Copy
Species: Gallus gallus
Genetic Insert: c-src K295R
Vector Backbone Description: Backbone Size:6400; Vector Backbone:pEVX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: Based on plasmid pM5HHB5.
Proper citation: RRID:Addgene_17678 Copy
Species: Gallus gallus
Genetic Insert: c-src K295R Y527F
Vector Backbone Description: Backbone Size:6400; Vector Backbone:pEVX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: Based on plasmid pM5HHB5. This plasmid is unpublished, but related to this article.
Proper citation: RRID:Addgene_17679 Copy
Species: Gallus gallus
Genetic Insert: c-src S12A
Vector Backbone Description: Backbone Size:6400; Vector Backbone:pEVX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: The pM5HHB5 c-src sequence between nucleotide 1 (numbering from the c-src translational initiator ATG) and nucleotide 43 (at an NaeI site) was replaced with the sequence ATGGGGAGTAGCAAGAGCAAGCCTAAGGATC
CCGCTCAGCGCC in pcAlal2. This introduced MstII and BamHI restriction sites near
nucleotides 25 and 29, respectively, and changed the AGC (Ser) 12 codon to GCT (Ala) codon yet preserved the remaining the c-src amino acid sequence.
Proper citation: RRID:Addgene_17680 Copy
Species: Gallus gallus
Genetic Insert: c-src S12A S17A
Vector Backbone Description: Backbone Size:6400; Vector Backbone:pEVX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: Based on plasmid pM5HHB5.
Proper citation: RRID:Addgene_17682 Copy
Species: Gallus gallus
Genetic Insert: c-src S12A Y527F
Vector Backbone Description: Backbone Size:6400; Vector Backbone:pEVX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: Based on plasmid pM5HHB5.
Proper citation: RRID:Addgene_17683 Copy
Species: Gallus gallus
Genetic Insert: c-src S17A Y527F
Vector Backbone Description: Backbone Size:6400; Vector Backbone:pEVX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: Based on plasmid pM5HHB5.
Proper citation: RRID:Addgene_17684 Copy
Species: Gallus gallus
Genetic Insert: NgCAM
Vector Backbone Description: Vector Backbone:pBa-mCherry; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: Please note: Plasmid contains a K609E mutation in NgCAM compared to the depositor's provided sequence. This mutation is not known to affect plasmid function.
Proper citation: RRID:Addgene_180248 Copy
Species: Gallus gallus
Genetic Insert: GgPCFT_NB
Vector Backbone Description: Backbone Size:6994; Vector Backbone:pBXNPHM3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_165415 Copy
Species: Gallus gallus
Genetic Insert: DCTN1
Vector Backbone Description: Backbone Size:4800; Vector Backbone:pGW1-CMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_51221 Copy
Species: Gallus gallus
Genetic Insert: DCTN1
Vector Backbone Description: Backbone Size:4800; Vector Backbone:pGW1-CMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_51412 Copy
Species: Gallus gallus
Genetic Insert: BMPR-1B DN
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:2959; Vector Backbone:pBluescript SK+; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments: The BMPR-1B insert in this plasmid contains P2A, M11V and S18G mutations when compared to GenBank reference sequence NP_990463.1. These mutations are not a concern for the function of the plasmid, as described in the associated publication.
Proper citation: RRID:Addgene_49529 Copy
Species: Gallus gallus
Genetic Insert: BMPR-1B CA
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:2959; Vector Backbone:pBluescript SK+; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments: The BMPR-1B insert in this plasmid contains P2A, M11V and S18G mutations when compared to GenBank reference sequence NP_990463.1. These mutations are not a concern for the function of the plasmid, as described in the associated publication.
Proper citation: RRID:Addgene_49528 Copy
Species: Gallus gallus
Genetic Insert: Paxillin-KM
Vector Backbone Description: Backbone Size:4750; Vector Backbone:mApple-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments: . Excitation = 568; Emission = 592
Proper citation: RRID:Addgene_54936 Copy
Species: Gallus gallus
Genetic Insert: FAK
Vector Backbone Description: Backbone Size:4750; Vector Backbone:mApple; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments: . Excitation = 568; Emission = 592
Proper citation: RRID:Addgene_54898 Copy
Species: Gallus gallus
Genetic Insert: C-Src
Vector Backbone Description: Backbone Size:4750; Vector Backbone:mApple; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments: . Excitation = 568; Emission = 592
Proper citation: RRID:Addgene_54868 Copy
Species: Gallus gallus
Genetic Insert: C-Src DN
Vector Backbone Description: Backbone Size:4750; Vector Backbone:mCherry; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments: Kinase Dead K295R. Excitation = 587; Emission = 610
Proper citation: RRID:Addgene_55003 Copy
Species: Gallus gallus
Genetic Insert: C-Src
Vector Backbone Description: Backbone Size:4750; Vector Backbone:mCherry; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments: . Excitation = 587; Emission = 610
Proper citation: RRID:Addgene_55002 Copy
Species: Gallus gallus
Genetic Insert: CCPB1
Vector Backbone Description: Backbone Size:4750; Vector Backbone:mCherry-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments: . Excitation = 587; Emission = 610
Proper citation: RRID:Addgene_55009 Copy
Species: Gallus gallus
Genetic Insert: CCPB1
Vector Backbone Description: Backbone Size:4750; Vector Backbone:mCherry-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments: . Excitation = 587; Emission = 610
Proper citation: RRID:Addgene_55010 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.