Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
PCDF Bravo-PotH-OL3del Resource Report Resource Website |
RRID:Addgene_216751 | potH | Other | Streptomycin | PMID: | IPTG inducible | Vector Backbone:PCDF Bravo ; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin | Outer loop 3 (OL3) with the sequence of [ELLGGPDSIMIGRVLWQEFFNNRDW] is deleted. | 2024-08-01 01:06:53 | 0 |
|
pHBJT014 Resource Report Resource Website |
RRID:Addgene_225165 | Streptomycin | PMID:39244484 | Low copy plasmid (pSC101 ori and repA), pUC18 MCS with FLAG epitope integrated at SmaI site, confers streptomycin resistance | Backbone Size:4769; Vector Backbone:Unknown; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Streptomycin | 2024-09-12 01:06:59 | 0 | |||
|
pHBJT013 Resource Report Resource Website |
RRID:Addgene_225164 | Streptomycin | PMID:39244484 | Low copy plasmid (pSC101 ori and repA), pUC19 MCS with FLAG epitope integrated at SmaI site, confers streptomycin resistance | Backbone Size:4769; Vector Backbone:Unknown; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Streptomycin | 2024-09-12 01:06:59 | 0 | |||
|
pHBJT023 Resource Report Resource Website |
RRID:Addgene_225174 | Streptomycin | PMID:39244484 | Low copy plasmid (pSC101 ori and repA), pUC19 MCS, confers streptomycin resistance | Backbone Size:5007; Vector Backbone:Unknown; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Streptomycin | 2024-09-12 01:06:59 | 0 | |||
|
pCDFDuet-1:ChrH-ChrI Resource Report Resource Website |
RRID:Addgene_225083 | ChrH | Other | Streptomycin | PMID:37252350 | Also encodes ChrI (no tag) | Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin | WT | 2024-10-18 01:07:13 | 0 |
|
pGMCS-0X-P38-PanBmGFP Resource Report Resource Website |
RRID:Addgene_27127 | PanB | Other | Streptomycin | PMID:20711362 | Backbone Size:5400; Vector Backbone:pGMCS; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin | 2024-12-20 04:08:58 | 0 | ||
|
pFNC-4 Resource Report Resource Website |
RRID:Addgene_227668 | SmR | Other | Streptomycin | PMID:39778677 | Backbone Size:6370; Vector Backbone:pFNC-6; Vector Types:Bacterial Expression, Other; Bacterial Resistance:Streptomycin | 2025-01-24 04:08:46 | 0 | ||
|
pCIFR-4 Resource Report Resource Website |
RRID:Addgene_227664 | msfGFP | Synthetic | Streptomycin | PMID:39778677 | Backbone Size:4730; Vector Backbone:pBAMD1-4; Vector Types:Bacterial Expression, Other; Bacterial Resistance:Streptomycin | 2025-01-24 04:08:46 | 0 | ||
|
pENTR223 CD147, open Resource Report Resource Website |
RRID:Addgene_149720 | CD147 | Homo sapiens | Streptomycin | PMID: | cloned from cDNA generated from mRNA of human BJ cells (ATCC CRL-2522) by reverse transcription | Vector Backbone:pENTR223; Vector Types:Other, Entry vector; Bacterial Resistance:Streptomycin | wt, without stop codon | 2022-04-22 03:27:55 | 0 |
|
pENTR223 TMPRSS2, closed Resource Report Resource Website |
RRID:Addgene_149721 | TMPRSS2 | Homo sapiens | Streptomycin | PMID: | HQ448630 | Vector Backbone:pENTR223; Vector Types:Other, Entry vector; Bacterial Resistance:Streptomycin | wt, without start codon | 2022-04-22 03:27:55 | 0 |
|
pDLlR6 Resource Report Resource Website |
RRID:Addgene_172559 | LacI-mRFP | Synthetic | Streptomycin | PMID: | Backbone Marker:Novagen; Vector Backbone:original Duet vector; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Streptomycin | 2022-04-22 03:33:03 | 0 | ||
|
pDCyR6 Resource Report Resource Website |
RRID:Addgene_172558 | CymRAM-mRFP | Synthetic | Streptomycin | PMID: | Backbone Marker:Novagen; Vector Backbone:original Duet vector; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Streptomycin | 2022-04-22 03:33:03 | 0 | ||
|
pELlR6 Resource Report Resource Website |
RRID:Addgene_172562 | LacI-mRFP | Synthetic | Streptomycin | PMID: | Backbone Marker:Novagen; Vector Backbone:original Duet vector; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Streptomycin | 2022-04-22 03:33:03 | 0 | ||
|
pDLxR6 Resource Report Resource Website |
RRID:Addgene_172560 | LuxR-mRFP | Synthetic | Streptomycin | PMID: | Backbone Marker:Novagen; Vector Backbone:original Duet vector; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Streptomycin | 2022-04-22 03:33:03 | 0 | ||
|
pECO300 Resource Report Resource Website |
RRID:Addgene_169766 | Streptomycin | PMID:32190101 | Vector Backbone:pHAtC; Vector Types:Plant Expression, Other, Plant Binary vector; Bacterial Resistance:Streptomycin | 2022-04-22 03:32:17 | 0 | ||||
|
Syn61 Resource Report Resource Website |
RRID:Addgene_174513 | Recoded E. coli strain without TCG, TCA, or TAG codons | Streptomycin | PMID:31092918 | The compressed genome of Syn61 was designed by systematically replacing the TCG, TCA, and TAG codons with their synonyms AGC, AGT, and TAA, respectively, in all open reading frames. Genotyping primers for presence of synthetic insert in 100k01 in Syn61 strain: GE282 AAAAAGGTCGGGCCGGACGGTC GE283 GCAATAATGGCAGCCACACCTTG | Vector Backbone:NA; Vector Types:Other; Bacterial Resistance:Streptomycin | 2022-04-22 03:33:22 | 0 | ||
|
Syn61Δ3(ev5) Resource Report Resource Website |
RRID:Addgene_174514 | Recoded E. coli strain without TCG, TCA, or TAG codons in the open reading frames and deleted serT, serU and prfA genes | Streptomycin | PMID:34083482 | From the Syn61 strain (Addgene #174513), two rounds of parallel mutagenesis and dynamic selection were followed by deletion of the serT, serU and prfA genes, and a further three rounds of parallel mutagenesis and dynamic selection yielded Syn61Δ3(ev5) (Addgene #174514). Genotyping primers for presence of synthetic insert in 100k01 in Syn61 strain: GE282 AAAAAGGTCGGGCCGGACGGTC GE283 GCAATAATGGCAGCCACACCTTG Genotyping for deletion of serU gene: GE1147 TACGAATGATGCCTCGCCGCAAATAAG GE1148 CCTCACGCAACGGAATAAAGGGAACTC Genotyping for deletion of serT gene: GE1215 AGCGTCAGGCTCAGCAGAAAATAGG GE1216 ACGTCCCTGTAGCAAGGCAAACCATC Genotyping for deletion of prfA gene: v13-1011 GACTAACCGCTTGATCCATGCGC v13-1012 CAAGTTGCTGACATTGTTCGTCAGTCAGC | Vector Backbone:NA; Vector Types:Other; Bacterial Resistance:Streptomycin | 2022-04-22 03:33:22 | 0 | ||
|
pCDF RBP-FL P53 Resource Report Resource Website |
RRID:Addgene_174042 | P53 gene | Homo sapiens | Streptomycin | PMID:33263541 | Backbone Marker:Novagen; Backbone Size:3781; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin | 2022-04-22 03:33:16 | 0 | ||
|
drApo1–T7 Resource Report Resource Website |
RRID:Addgene_156461 | rApoI | Rattus norvegicus | Streptomycin | PMID:29991261 | Esherichia coli strain that expresses a deactivated variant of MutaT7, a fusion of rat APOBEC1 and the T7 RNA polymerase. Genotype: DH10B Δung ΔmotAB ΔcsgABCDEFG [PlacI<>Ptac] Δ(araA-leu)7697::[PA1lacO-Tenth drApo1-T7] | Vector Backbone:None; Vector Types:; Bacterial Resistance:Streptomycin | Glutamate 63 is mutated to Glutamine | 2022-04-22 03:29:11 | 0 |
|
BJ5183 cells Resource Report Resource Website |
RRID:Addgene_16398 | BJ5183 bacterial cells | E. coli | Streptomycin | PMID:9482916 | This is a bacterial strain - not a plasmid. Select with 30 ug/mL streptomycin. Electrocompetent BJ5183 cells are used to carry out the recombination between the shuttle vector (pShuttle, pShuttle-CMV, pAdTrack, or pAdTrack-CMV) and the adenoviral vector (pAdEasy1 or pAdEasy2). See attached protocol and http://www.coloncancer.org/adeasy.htm for more information. | Backbone Size:0; Vector Backbone:n/a; Vector Types:; Bacterial Resistance:Streptomycin | 2022-04-22 03:31:05 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
