Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species:
Genetic Insert:
Vector Backbone Description: Backbone Size:5261; Vector Backbone:CloDF13; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Streptomycin
References:
Comments:
Proper citation: RRID:Addgene_213132 Copy
Species:
Genetic Insert:
Vector Backbone Description: Backbone Size:4769; Vector Backbone:Unknown; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Streptomycin
References:
Comments: Low copy plasmid (pSC101 ori and repA), pUC18 MCS with FLAG epitope integrated at SmaI site, confers streptomycin resistance
Proper citation: RRID:Addgene_225165 Copy
Species:
Genetic Insert:
Vector Backbone Description: Backbone Size:4769; Vector Backbone:Unknown; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Streptomycin
References:
Comments: Low copy plasmid (pSC101 ori and repA), pUC19 MCS with FLAG epitope integrated at SmaI site, confers streptomycin resistance
Proper citation: RRID:Addgene_225164 Copy
Species:
Genetic Insert:
Vector Backbone Description: Backbone Size:5007; Vector Backbone:Unknown; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Streptomycin
References:
Comments: Low copy plasmid (pSC101 ori and repA), pUC19 MCS, confers streptomycin resistance
Proper citation: RRID:Addgene_225174 Copy
Species: Other
Genetic Insert: ChrH
Vector Backbone Description: Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
References:
Comments: Also encodes ChrI (no tag)
Proper citation: RRID:Addgene_225083 Copy
Species: Other
Genetic Insert: PanB
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pGMCS; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
References:
Comments:
Proper citation: RRID:Addgene_27127 Copy
Species: Other
Genetic Insert: SmR
Vector Backbone Description: Backbone Size:6370; Vector Backbone:pFNC-6; Vector Types:Bacterial Expression, Other; Bacterial Resistance:Streptomycin
References:
Comments:
Proper citation: RRID:Addgene_227668 Copy
Species: Synthetic
Genetic Insert: msfGFP
Vector Backbone Description: Backbone Size:4730; Vector Backbone:pBAMD1-4; Vector Types:Bacterial Expression, Other; Bacterial Resistance:Streptomycin
References:
Comments:
Proper citation: RRID:Addgene_227664 Copy
Species: Homo sapiens
Genetic Insert: CD147
Vector Backbone Description: Vector Backbone:pENTR223; Vector Types:Other, Entry vector; Bacterial Resistance:Streptomycin
References:
Comments: cloned from cDNA generated from mRNA of human BJ cells (ATCC CRL-2522) by reverse transcription
Proper citation: RRID:Addgene_149720 Copy
Species: Homo sapiens
Genetic Insert: TMPRSS2
Vector Backbone Description: Vector Backbone:pENTR223; Vector Types:Other, Entry vector; Bacterial Resistance:Streptomycin
References:
Comments: HQ448630
Proper citation: RRID:Addgene_149721 Copy
Species: Synthetic
Genetic Insert: LacI-mRFP
Vector Backbone Description: Backbone Marker:Novagen; Vector Backbone:original Duet vector; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Streptomycin
References:
Comments:
Proper citation: RRID:Addgene_172559 Copy
Species: Synthetic
Genetic Insert: CymRAM-mRFP
Vector Backbone Description: Backbone Marker:Novagen; Vector Backbone:original Duet vector; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Streptomycin
References:
Comments:
Proper citation: RRID:Addgene_172558 Copy
Species: Synthetic
Genetic Insert: LacI-mRFP
Vector Backbone Description: Backbone Marker:Novagen; Vector Backbone:original Duet vector; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Streptomycin
References:
Comments:
Proper citation: RRID:Addgene_172562 Copy
Species: Synthetic
Genetic Insert: LuxR-mRFP
Vector Backbone Description: Backbone Marker:Novagen; Vector Backbone:original Duet vector; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Streptomycin
References:
Comments:
Proper citation: RRID:Addgene_172560 Copy
Species:
Genetic Insert:
Vector Backbone Description: Vector Backbone:pHAtC; Vector Types:Plant Expression, Other, Plant Binary vector; Bacterial Resistance:Streptomycin
References:
Comments:
Proper citation: RRID:Addgene_169766 Copy
Species:
Genetic Insert: Recoded E. coli strain without TCG, TCA, or TAG codons
Vector Backbone Description: Vector Backbone:NA; Vector Types:Other; Bacterial Resistance:Streptomycin
References:
Comments: The compressed genome of Syn61 was designed by systematically replacing the TCG, TCA, and TAG codons with their synonyms AGC, AGT, and TAA, respectively, in all open reading frames.
Genotyping primers for presence of synthetic insert in 100k01 in Syn61 strain:
GE282 AAAAAGGTCGGGCCGGACGGTC
GE283 GCAATAATGGCAGCCACACCTTG
Proper citation: RRID:Addgene_174513 Copy
Species:
Genetic Insert: Recoded E. coli strain without TCG, TCA, or TAG codons in the open reading frames and deleted serT, serU and prfA genes
Vector Backbone Description: Vector Backbone:NA; Vector Types:Other; Bacterial Resistance:Streptomycin
References:
Comments: From the Syn61 strain (Addgene #174513), two rounds of parallel mutagenesis and dynamic selection were followed by deletion of the serT, serU and prfA genes, and a further three rounds of parallel mutagenesis and dynamic selection yielded Syn61Δ3(ev5) (Addgene #174514).
Genotyping primers for presence of synthetic insert in 100k01 in Syn61 strain:
GE282 AAAAAGGTCGGGCCGGACGGTC
GE283 GCAATAATGGCAGCCACACCTTG
Genotyping for deletion of serU gene:
GE1147 TACGAATGATGCCTCGCCGCAAATAAG
GE1148 CCTCACGCAACGGAATAAAGGGAACTC
Genotyping for deletion of serT gene:
GE1215 AGCGTCAGGCTCAGCAGAAAATAGG
GE1216 ACGTCCCTGTAGCAAGGCAAACCATC
Genotyping for deletion of prfA gene:
v13-1011 GACTAACCGCTTGATCCATGCGC
v13-1012 CAAGTTGCTGACATTGTTCGTCAGTCAGC
Proper citation: RRID:Addgene_174514 Copy
Species: Homo sapiens
Genetic Insert: P53 gene
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:3781; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
References:
Comments:
Proper citation: RRID:Addgene_174042 Copy
Species: Rattus norvegicus
Genetic Insert: rApoI
Vector Backbone Description: Vector Backbone:None; Vector Types:; Bacterial Resistance:Streptomycin
References:
Comments: Esherichia coli strain that expresses a deactivated variant of MutaT7, a fusion of rat APOBEC1 and the T7 RNA polymerase. Genotype: DH10B Δung ΔmotAB ΔcsgABCDEFG [PlacI<>Ptac] Δ(araA-leu)7697::[PA1lacO-Tenth drApo1-T7]
Proper citation: RRID:Addgene_156461 Copy
Species: E. coli
Genetic Insert: BJ5183 bacterial cells
Vector Backbone Description: Backbone Size:0; Vector Backbone:n/a; Vector Types:; Bacterial Resistance:Streptomycin
References:
Comments: This is a bacterial strain - not a plasmid. Select with 30 ug/mL streptomycin.
Electrocompetent BJ5183 cells are used to carry out the recombination between the shuttle vector (pShuttle, pShuttle-CMV, pAdTrack, or pAdTrack-CMV) and the adenoviral vector (pAdEasy1 or pAdEasy2).
See attached protocol and http://www.coloncancer.org/adeasy.htm
for more information.
Proper citation: RRID:Addgene_16398 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.