Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pEN_TTmcs Resource Report Resource Website 1+ mentions |
RRID:Addgene_25755 | Gentamicin | PMID:16945906 | shRNA expression; miR30-based topology; TRE-TIGHT Pmin promoter + DsRed2 spacer; Entry vector backbone; +ccdB in parent; Spe1 d/s of TRE-TIGHT | Backbone Marker:ATCC 10326362; Backbone Size:4218; Vector Backbone:pENTR1A-Gent; Vector Types:Other, Entry vector; Bacterial Resistance:Gentamicin | 2023-04-01 01:05:41 | 1 | |||
|
pEN_hU6miR-G12-E Resource Report Resource Website |
RRID:Addgene_25757 | G alpha 12 miR-shRNA | Mus musculus | Gentamicin | PMID:16945906 | Entry vector with U6-driven G alpha 12 miR-shRNA G alpha 12 miR-shRNA: GCGACACCATCTTCGACAACAT Addgene sequence shows that this plasmid is missing the EcoRI site. | Backbone Marker:ATCC 10326362; Backbone Size:4310; Vector Backbone:pENTR1A-Gent; Vector Types:Other, Entry vector; Bacterial Resistance:Gentamicin | 2023-04-01 01:05:42 | 0 | |
|
pEN_TTmiRc2 Resource Report Resource Website |
RRID:Addgene_25752 | Gentamicin | PMID:16945906 | shRNA expression; miR30-based topology; TRE-TIGHT Pmin promoter; Entry vector backbone; +ccdB in parent; Spe1 d/s of TRE-TIGHT | Backbone Marker:ATCC 10326362; Backbone Size:4422; Vector Backbone:pENTR1A-Gent; Vector Types:Other, Entry vector; Bacterial Resistance:Gentamicin | 2023-04-01 01:05:41 | 0 | |||
|
pEN_Tmcs Resource Report Resource Website |
RRID:Addgene_25751 | Gentamicin | PMID:16945906 | TRE Pmin promoter; Entry vector backbone; +ccdB in parent; Multiple cloning sites d/s of TRE | Backbone Marker:ATCC 10326362; Backbone Size:4347; Vector Backbone:pENTR1A-Gent; Vector Types:Other, Entry vector; Bacterial Resistance:Gentamicin | 2023-04-01 01:05:41 | 0 | |||
|
pFTtR5 Resource Report Resource Website |
RRID:Addgene_167508 | TtgRAM-mRFP | Synthetic | Gentamicin | PMID:34125913 | Vector Backbone:pFTtR5; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Gentamicin | 2023-04-01 01:04:09 | 0 | ||
|
pFTR5 Resource Report Resource Website |
RRID:Addgene_167507 | TetR-RFP | Synthetic | Gentamicin | PMID:34125913 | Vector Backbone:pFTR5; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Gentamicin | 2023-04-01 01:04:09 | 0 | ||
|
pACEBac1-GCP5 Resource Report Resource Website |
RRID:Addgene_178071 | GCP5 | Homo sapiens | Gentamicin | PMID:33496729 | Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin | 2023-04-01 01:04:45 | 0 | ||
|
pACEBac1-GCP6 Resource Report Resource Website |
RRID:Addgene_178072 | GCP6 | Homo sapiens | Gentamicin | PMID:33496729 | Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin | 2023-04-01 01:04:45 | 0 | ||
|
pACEBac1-gamma-tubulin(N229A)-TEV-His6 Resource Report Resource Website |
RRID:Addgene_178077 | gamma-tubulin with an N229A point mutation | Homo sapiens | Gentamicin | PMID:33496729 | Primers used to generate pACEBac1-gamma-tubulin(N229A)-TEV-His6 via site-directed mutagenesis were CCCATCCTTCTCCCAGATCGCCCAGCTGGTGTCTACCATCATGTC and GACATGATGGTAGACACCAGCTGGGCGATCTGGGAGAAGGATGGG | Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin | Changed Asparagine 229 to Alanine | 2023-04-01 01:04:46 | 0 |
|
pACEBac1-MZT1 Resource Report Resource Website |
RRID:Addgene_178075 | MZT1 | Homo sapiens | Gentamicin | PMID:33496729 | Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin | 2023-04-01 01:04:46 | 0 | ||
|
pWVR5 Resource Report Resource Website |
RRID:Addgene_167509 | VanRAM-mRFP | Synthetic | Gentamicin | PMID:34125913 | Vector Backbone:pWVR5; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Gentamicin | 2023-04-01 01:04:10 | 0 | ||
|
pUAS-Luc Resource Report Resource Website |
RRID:Addgene_21604 | UAS-hsp70 luciferase | Gentamicin | PMID:19481053 | Backbone Marker:Stratagene; Backbone Size:3415; Vector Backbone:pBluescript SK(-); Vector Types:Insect Expression; Bacterial Resistance:Gentamicin | 2023-04-01 01:05:31 | 0 | |||
|
pEN_TRE_GFP Resource Report Resource Website |
RRID:Addgene_25767 | Gentamicin | PMID:16945906 | Entry vector with TRE-driven GFP | Backbone Marker:ATCC 10326362; Backbone Size:4655; Vector Backbone:pENTR1A-Gent; Vector Types:Other, Entry vector; Bacterial Resistance:Gentamicin | 2023-04-01 01:05:42 | 0 | |||
|
pEN_TmiR_G13-L_G12-E Resource Report Resource Website |
RRID:Addgene_25763 | G alpha 13 and 12 miR-shRNA | Mus musculus | Gentamicin | PMID:16945906 | Entry vector with TRE-driven G alpha 12 and 13 miR-shRNA G alpha 12 miR-shRNA: GCGACACCATCTTCGACAACAT G alpha 13 miR-shRNA: CTGGGTGAGTCTGTAAAGTATT There are 3 minor changes between depositor's sequence and Addgene's sequence - An extra T between the TRE promoter and first shRNA; a 17nt stretch between the shRNAs is different but will not affect function; and a single nt change mutates an EcoRI site just beyond the 2nd shRNA but will again not affect function. | Backbone Marker:ATCC 10326362; Backbone Size:4641; Vector Backbone:pENTR1A-Gent; Vector Types:Other, Entry vector; Bacterial Resistance:Gentamicin | 2023-04-01 01:05:42 | 0 | |
|
pDON207 NSP3 K977Q Resource Report Resource Website |
RRID:Addgene_180057 | SARS-CoV-2 NSP3 K977Q | Other | Gentamicin | PMID:34709727 | Vector Backbone:pDON207; Vector Types:Mammalian Expression; Bacterial Resistance:Gentamicin | NSP3 K977Q | 2023-04-01 01:04:50 | 0 | |
|
pEN_TmiR_G13-L Resource Report Resource Website |
RRID:Addgene_25762 | G alpha 13 miR-shRNA | Mus musculus | Gentamicin | PMID:16945906 | Entry vector with TRE-driven G alpha 13 miR-shRNA G alpha 13 miR-shRNA: CTGGGTGAGTCTGTAAAGTATT Addgene sequence shows that this plasmid is missing the SpeI site. | Backbone Marker:ATCC 10326362; Backbone Size:4259; Vector Backbone:pENTR1A-Gent; Vector Types:Other, Entry vector; Bacterial Resistance:Gentamicin | 2023-04-01 01:05:42 | 0 | |
|
pEN_TmiR_Gb2-K Resource Report Resource Website |
RRID:Addgene_25764 | Gb2 miR-shRNA | Mus musculus | Gentamicin | PMID:16945906 | Entry vector with TRE-driven G beta 2 miR-shRNA: TGCTCATGTATTCCCACGACAA Addgene sequence shows that this plasmid is missing the SpeI site. | Backbone Marker:ATCC 10326362; Backbone Size:4259; Vector Backbone:pENTR1A-Gent; Vector Types:Other, Entry vector; Bacterial Resistance:Gentamicin | 2023-04-01 01:05:42 | 0 | |
|
pEN_TmiR_Luc-A Resource Report Resource Website |
RRID:Addgene_25760 | Luciferase miR-shRNA | Gentamicin | PMID:16945906 | Entry vector with TRE-driven luciferase miR-shRNA Luciferase shRNA sequence is - 5'- CCCGCCTGAAGTCTCTGATTAATAGTGAAGCC ACAGATGTATTAATCAGAGACTTCAGGCGGT | Backbone Marker:ATCC 10326362; Backbone Size:4259; Vector Backbone:pENTR1A-Gent; Vector Types:Other, Entry vector; Bacterial Resistance:Gentamicin | 2023-04-01 01:05:42 | 0 | ||
|
pPPC030.306 Resource Report Resource Website |
RRID:Addgene_171151 | J306 scRNA | Synthetic | Gentamicin | PMID:33930546 | Alternative names: pCK162, pBBR1-GmR_J3-BBa_J23117-mvaES | Backbone Marker:Jesse Zalatan; Backbone Size:6261; Vector Backbone:pPPC020.306; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Gentamicin | 2023-04-01 01:04:21 | 0 | |
|
pACEBac1-gamma-tubulin-TEV-His6 Resource Report Resource Website |
RRID:Addgene_178067 | gamma-tubulin | Homo sapiens | Gentamicin | PMID:33496729 | Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin | 2023-04-01 01:04:45 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
