Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: mouse immunoglobulin heavy chain IgG3 isotype
Vector Backbone Description: Backbone Marker:Invivogen; Backbone Size:4501; Vector Backbone:pFUSEss-CHIg-mG3; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
References:
Comments:
Proper citation: RRID:Addgene_82356 Copy
Species: Mus musculus
Genetic Insert: mouse immunoglobulin heavy chain IgG1 isotype
Vector Backbone Description: Backbone Marker:Invivogen; Backbone Size:4492; Vector Backbone:pFUSEss-CHIg-mG1; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
References:
Comments:
Proper citation: RRID:Addgene_82357 Copy
Species: Mus musculus
Genetic Insert: immunoglobulin heavy constant mu
Vector Backbone Description: Backbone Marker:Invivogen; Backbone Size:4852; Vector Backbone:pFUSEss-CHIg-mM; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
References:
Comments:
Proper citation: RRID:Addgene_91738 Copy
Species: Other
Genetic Insert: Full genome of BoPyV2a isolate S22
Vector Backbone Description: Backbone Marker:Christopher Buck lab, Addgene plasmid 24755; Backbone Size:2131; Vector Backbone:pFunnyfarm; Vector Types:Other, Viral clone; Bacterial Resistance:Bleocin (Zeocin)
References:
Comments: Genome can be liberated by digestion with SacII
Proper citation: RRID:Addgene_62356 Copy
Species: Mus musculus
Genetic Insert: immunoglobulin heavy constant mu
Vector Backbone Description: Backbone Marker:Invivogen; Backbone Size:4852; Vector Backbone:pFUSEss-CHIg-mM; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
References:
Comments:
Proper citation: RRID:Addgene_91734 Copy
Species: Mus musculus
Genetic Insert: immunoglobulin heavy constant mu
Vector Backbone Description: Backbone Marker:Invivogen; Backbone Size:4852; Vector Backbone:pFUSEss-CHIg-mM; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
References:
Comments:
Proper citation: RRID:Addgene_91735 Copy
Species: Mus musculus
Genetic Insert: immunoglobulin heavy constant mu
Vector Backbone Description: Backbone Marker:Invivogen; Backbone Size:4852; Vector Backbone:pFUSEss-CHIg-mM; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
References:
Comments:
Proper citation: RRID:Addgene_91732 Copy
Species: Mus musculus
Genetic Insert: immunoglobulin heavy constant mu
Vector Backbone Description: Backbone Marker:Invivogen; Backbone Size:4852; Vector Backbone:pFUSEss-CHIg-mM; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
References:
Comments:
Proper citation: RRID:Addgene_91730 Copy
Species: Other
Genetic Insert: Full genome of BoPyV3 isolate S22
Vector Backbone Description: Backbone Marker:Christopher Buck lab, Addgene plasmid 24755; Backbone Size:2131; Vector Backbone:pFunnyfarm; Vector Types:Other, Viral clone; Bacterial Resistance:Bleocin (Zeocin)
References:
Comments: Genome can be liberated by digestion with EcoRI
Proper citation: RRID:Addgene_62368 Copy
Species: Other
Genetic Insert: Full genome of BoPyV3 isolate S23
Vector Backbone Description: Backbone Marker:Christopher Buck lab, Addgene plasmid 24755; Backbone Size:2131; Vector Backbone:pFunnyfarm; Vector Types:Other, Viral clone; Bacterial Resistance:Bleocin (Zeocin)
References:
Comments: Genome can be liberated by digestion with EcoRI
Proper citation: RRID:Addgene_62369 Copy
Species: Other
Genetic Insert: BmAgo3
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2900; Vector Backbone:pIZ/V5-His; Vector Types:Insect Expression; Bacterial Resistance:Bleocin (Zeocin)
References:
Comments:
Proper citation: RRID:Addgene_50559 Copy
Species: Murine Polyomavirus
Genetic Insert: MPyV VP2
Vector Backbone Description: Backbone Size:3973; Vector Backbone:phGf; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
References:
Comments: First reference to this plasmid was in:
Human Merkel cell polyomavirus infection II. MCV is a common human infection that can be detected by conformational capsid epitope immunoassays. Tolstov YL, Pastrana DV, Feng H, Becker JC, Jenkins FJ, Moschos S, Chang Y, Buck CB, Moore PS. Int J Cancer. 2009 Sep 15.125(6):1250-6
Genbank style annotations can be found at:
http://home.ccr.cancer.gov/LCO/packaging.htm
Proper citation: RRID:Addgene_22520 Copy
Species: Homo sapiens
Genetic Insert: PLD4
Vector Backbone Description: Backbone Marker:Nemazee lab (Deli); Backbone Size:2000; Vector Backbone:SuExp; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
References:
Comments:
Proper citation: RRID:Addgene_173852 Copy
Species: Homo sapiens
Genetic Insert: PLD3
Vector Backbone Description: Backbone Marker:Nemazee lab (Deli); Backbone Size:2000; Vector Backbone:SuExp; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
References:
Comments:
Proper citation: RRID:Addgene_173851 Copy
Species: Other
Genetic Insert: dsRed-Express
Vector Backbone Description: Vector Backbone:custom; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
References:
Comments: This plasmid is nearly identical to pRwB (http://www.addgene.org/48734), except that it contains a 2kb stuffer region to bring its size closer to the ~8kb native papillomavirus genome. For more information on using this plasmid, please see the following website: http://home.ccr.cancer.gov/Lco/target.htm
Proper citation: RRID:Addgene_48733 Copy
Species: Homo sapiens
Genetic Insert: p21
Vector Backbone Description: Backbone Marker:Invivogen; Vector Backbone:pCAG; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
References:
Comments:
Proper citation: RRID:Addgene_40205 Copy
Species: Homo sapiens
Genetic Insert: p21
Vector Backbone Description: Backbone Marker:Invivogen; Vector Backbone:pCAG; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
References:
Comments:
Proper citation: RRID:Addgene_42623 Copy
Species: Merkel Cell Polyomavirus
Genetic Insert: MCPyV VP1
Vector Backbone Description: Backbone Size:5338; Vector Backbone:pGwf; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
References:
Comments: First reference to this plasmid was in:
Human Merkel cell polyomavirus infection II. MCV is a common human infection that can be detected by conformational capsid epitope immunoassays. Tolstov YL, Pastrana DV, Feng H, Becker JC, Jenkins FJ, Moschos S, Chang Y, Buck CB, Moore PS. Int J Cancer. 2009 Sep 15.125(6):1250-6
Genbank style annotations can be found at:
http://home.ccr.cancer.gov/LCO/packaging.htm
Proper citation: RRID:Addgene_22515 Copy
Species: synthetic
Genetic Insert: lox-EM7p-Zeo-lox cassette flanked by Tn5 outer element
Vector Backbone Description: Backbone Marker:Epicentre; Backbone Size:2000; Vector Backbone:pMOD
References:
Comments: Note that Bleomycin and Zeocin are the same antibiotic.
Proper citation: RRID:Addgene_27182 Copy
Species: Synthetic
Genetic Insert: TAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, SP-PAM, and tdTomato reporter. Compatible with S. pyogenes Cas9
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:CRISPR; Bacterial Resistance:Bleocin (Zeocin)
References:
Comments:
Proper citation: RRID:Addgene_48677 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.