Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 6 showing 101 ~ 120 out of 197 results
Snippet view Table view Download 197 Result(s)
Click the to add this resource to a Collection
  • RRID:Addgene_213132

http://www.addgene.org/213132

Species:
Genetic Insert:
Vector Backbone Description: Backbone Size:5261; Vector Backbone:CloDF13; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Streptomycin
References:
Comments:

Proper citation: RRID:Addgene_213132 Copy   


  • RRID:Addgene_225165

http://www.addgene.org/225165

Species:
Genetic Insert:
Vector Backbone Description: Backbone Size:4769; Vector Backbone:Unknown; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Streptomycin
References:
Comments: Low copy plasmid (pSC101 ori and repA), pUC18 MCS with FLAG epitope integrated at SmaI site, confers streptomycin resistance

Proper citation: RRID:Addgene_225165 Copy   


  • RRID:Addgene_225164

http://www.addgene.org/225164

Species:
Genetic Insert:
Vector Backbone Description: Backbone Size:4769; Vector Backbone:Unknown; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Streptomycin
References:
Comments: Low copy plasmid (pSC101 ori and repA), pUC19 MCS with FLAG epitope integrated at SmaI site, confers streptomycin resistance

Proper citation: RRID:Addgene_225164 Copy   


  • RRID:Addgene_225174

http://www.addgene.org/225174

Species:
Genetic Insert:
Vector Backbone Description: Backbone Size:5007; Vector Backbone:Unknown; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Streptomycin
References:
Comments: Low copy plasmid (pSC101 ori and repA), pUC19 MCS, confers streptomycin resistance

Proper citation: RRID:Addgene_225174 Copy   


  • RRID:Addgene_225083

http://www.addgene.org/225083

Species: Other
Genetic Insert: ChrH
Vector Backbone Description: Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
References:
Comments: Also encodes ChrI (no tag)

Proper citation: RRID:Addgene_225083 Copy   


http://www.addgene.org/27127

Species: Other
Genetic Insert: PanB
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pGMCS; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
References:
Comments:

Proper citation: RRID:Addgene_27127 Copy   


  • RRID:Addgene_227668

http://www.addgene.org/227668

Species: Other
Genetic Insert: SmR
Vector Backbone Description: Backbone Size:6370; Vector Backbone:pFNC-6; Vector Types:Bacterial Expression, Other; Bacterial Resistance:Streptomycin
References:
Comments:

Proper citation: RRID:Addgene_227668 Copy   


  • RRID:Addgene_227664

http://www.addgene.org/227664

Species: Synthetic
Genetic Insert: msfGFP
Vector Backbone Description: Backbone Size:4730; Vector Backbone:pBAMD1-4; Vector Types:Bacterial Expression, Other; Bacterial Resistance:Streptomycin
References:
Comments:

Proper citation: RRID:Addgene_227664 Copy   


  • RRID:Addgene_149720

http://www.addgene.org/149720

Species: Homo sapiens
Genetic Insert: CD147
Vector Backbone Description: Vector Backbone:pENTR223; Vector Types:Other, Entry vector; Bacterial Resistance:Streptomycin
References:
Comments: cloned from cDNA generated from mRNA of human BJ cells (ATCC CRL-2522) by reverse transcription

Proper citation: RRID:Addgene_149720 Copy   


http://www.addgene.org/149721

Species: Homo sapiens
Genetic Insert: TMPRSS2
Vector Backbone Description: Vector Backbone:pENTR223; Vector Types:Other, Entry vector; Bacterial Resistance:Streptomycin
References:
Comments: HQ448630

Proper citation: RRID:Addgene_149721 Copy   


  • RRID:Addgene_172559

http://www.addgene.org/172559

Species: Synthetic
Genetic Insert: LacI-mRFP
Vector Backbone Description: Backbone Marker:Novagen; Vector Backbone:original Duet vector; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Streptomycin
References:
Comments:

Proper citation: RRID:Addgene_172559 Copy   


  • RRID:Addgene_172558

http://www.addgene.org/172558

Species: Synthetic
Genetic Insert: CymRAM-mRFP
Vector Backbone Description: Backbone Marker:Novagen; Vector Backbone:original Duet vector; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Streptomycin
References:
Comments:

Proper citation: RRID:Addgene_172558 Copy   


  • RRID:Addgene_172562

http://www.addgene.org/172562

Species: Synthetic
Genetic Insert: LacI-mRFP
Vector Backbone Description: Backbone Marker:Novagen; Vector Backbone:original Duet vector; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Streptomycin
References:
Comments:

Proper citation: RRID:Addgene_172562 Copy   


  • RRID:Addgene_172560

http://www.addgene.org/172560

Species: Synthetic
Genetic Insert: LuxR-mRFP
Vector Backbone Description: Backbone Marker:Novagen; Vector Backbone:original Duet vector; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Streptomycin
References:
Comments:

Proper citation: RRID:Addgene_172560 Copy   


  • RRID:Addgene_169766

http://www.addgene.org/169766

Species:
Genetic Insert:
Vector Backbone Description: Vector Backbone:pHAtC; Vector Types:Plant Expression, Other, Plant Binary vector; Bacterial Resistance:Streptomycin
References:
Comments:

Proper citation: RRID:Addgene_169766 Copy   


  • RRID:Addgene_174513

http://www.addgene.org/174513

Species:
Genetic Insert: Recoded E. coli strain without TCG, TCA, or TAG codons
Vector Backbone Description: Vector Backbone:NA; Vector Types:Other; Bacterial Resistance:Streptomycin
References:
Comments: The compressed genome of Syn61 was designed by systematically replacing the TCG, TCA, and TAG codons with their synonyms AGC, AGT, and TAA, respectively, in all open reading frames. Genotyping primers for presence of synthetic insert in 100k01 in Syn61 strain: GE282 AAAAAGGTCGGGCCGGACGGTC GE283 GCAATAATGGCAGCCACACCTTG

Proper citation: RRID:Addgene_174513 Copy   


  • RRID:Addgene_174514

http://www.addgene.org/174514

Species:
Genetic Insert: Recoded E. coli strain without TCG, TCA, or TAG codons in the open reading frames and deleted serT, serU and prfA genes
Vector Backbone Description: Vector Backbone:NA; Vector Types:Other; Bacterial Resistance:Streptomycin
References:
Comments: From the Syn61 strain (Addgene #174513), two rounds of parallel mutagenesis and dynamic selection were followed by deletion of the serT, serU and prfA genes, and a further three rounds of parallel mutagenesis and dynamic selection yielded Syn61Δ3(ev5) (Addgene #174514). Genotyping primers for presence of synthetic insert in 100k01 in Syn61 strain: GE282 AAAAAGGTCGGGCCGGACGGTC GE283 GCAATAATGGCAGCCACACCTTG Genotyping for deletion of serU gene: GE1147 TACGAATGATGCCTCGCCGCAAATAAG GE1148 CCTCACGCAACGGAATAAAGGGAACTC Genotyping for deletion of serT gene: GE1215 AGCGTCAGGCTCAGCAGAAAATAGG GE1216 ACGTCCCTGTAGCAAGGCAAACCATC Genotyping for deletion of prfA gene: v13-1011 GACTAACCGCTTGATCCATGCGC v13-1012 CAAGTTGCTGACATTGTTCGTCAGTCAGC

Proper citation: RRID:Addgene_174514 Copy   


  • RRID:Addgene_174042

http://www.addgene.org/174042

Species: Homo sapiens
Genetic Insert: P53 gene
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:3781; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
References:
Comments:

Proper citation: RRID:Addgene_174042 Copy   


  • RRID:Addgene_156461

http://www.addgene.org/156461

Species: Rattus norvegicus
Genetic Insert: rApoI
Vector Backbone Description: Vector Backbone:None; Vector Types:; Bacterial Resistance:Streptomycin
References:
Comments: Esherichia coli strain that expresses a deactivated variant of MutaT7, a fusion of rat APOBEC1 and the T7 RNA polymerase. Genotype: DH10B Δung ΔmotAB ΔcsgABCDEFG [PlacI<>Ptac] Δ(araA-leu)7697::[PA1lacO-Tenth drApo1-T7]

Proper citation: RRID:Addgene_156461 Copy   


  • RRID:Addgene_16398

http://www.addgene.org/16398

Species: E. coli
Genetic Insert: BJ5183 bacterial cells
Vector Backbone Description: Backbone Size:0; Vector Backbone:n/a; Vector Types:; Bacterial Resistance:Streptomycin
References:
Comments: This is a bacterial strain - not a plasmid. Select with 30 ug/mL streptomycin. Electrocompetent BJ5183 cells are used to carry out the recombination between the shuttle vector (pShuttle, pShuttle-CMV, pAdTrack, or pAdTrack-CMV) and the adenoviral vector (pAdEasy1 or pAdEasy2). See attached protocol and http://www.coloncancer.org/adeasy.htm for more information.

Proper citation: RRID:Addgene_16398 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. Neuroscience Information Framework Resources

    Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within NIF that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X