Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Drosophila melanogaster
Genetic Insert: Crk
Vector Backbone Description: Backbone Marker:GE Healthcare Life Sciences; Backbone Size:4985; Vector Backbone:pGEX-6P-2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_131146 Copy
Species: Drosophila melanogaster
Genetic Insert: Crk
Vector Backbone Description: Backbone Size:10240; Vector Backbone:pTIGER; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_131137 Copy
Species: Drosophila melanogaster
Genetic Insert: CG6061
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2536; Vector Backbone:pDONR221; Vector Types:Other, Gateway DONR vector; Bacterial Resistance:Kanamycin
References:
Comments: Please note that the ORFs in this collection were cloned open-ended (without a stop codon).
Proper citation: RRID:Addgene_39677 Copy
Species: Drosophila melanogaster
Genetic Insert: CBP1-287
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:4900; Vector Backbone:pGEX-2T; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_182839 Copy
Species: Drosophila melanogaster
Genetic Insert: CIRL
Vector Backbone Description: Vector Backbone:pTL412; Vector Types:Other, transformation vector; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_69882 Copy
Species: Drosophila melanogaster
Genetic Insert: CIRL
Vector Backbone Description: Backbone Marker:Huang et al., 2009, PMID 19429710; Vector Backbone:pGE-attB-GMR; Vector Types:Other, phiC31-integration vector; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_69881 Copy
Species: Drosophila melanogaster
Genetic Insert: E(y)2
Vector Backbone Description: Vector Backbone:pBacPak; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_52288 Copy
Species: Drosophila melanogaster
Genetic Insert: OSS Gle N-terminal 3xFlag-3xHA Tag Donor Plasmid
Vector Backbone Description: Vector Backbone:pUC19; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
References:
Comments: Please visit https://www.biorxiv.org/content/10.1101/2020.12.18.423517v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_186657 Copy
Species: Drosophila melanogaster
Genetic Insert: Nbr sgRNA 2 Plasmid
Vector Backbone Description: Vector Backbone:pU6-BbsI-chiRNA; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
References:
Comments: sgRNA sequence: AGCTCCTCAATCACTTAACA. The corresponding genome sequence is: AGCTCCTCAATCACTTAACA.
Please visit https://www.biorxiv.org/content/10.1101/2020.12.18.423517v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_186664 Copy
Species: Drosophila melanogaster
Genetic Insert: Shu sgRNA Plasmid
Vector Backbone Description: Vector Backbone:pU6-BbsI-chiRNA; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
References:
Comments: sgRNA sequence: GATAGCTTTAGCGAATCGAT. The corresponding genome sequence is: GATAGCTTTAGCGAATCGAT.
Please visit https://www.biorxiv.org/content/10.1101/2020.12.18.423517v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_186656 Copy
Species: Drosophila melanogaster
Genetic Insert: Piwi sgRNA Plasmid
Vector Backbone Description: Vector Backbone:pU6-BbsI-chiRNA; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
References:
Comments: sgRNA sequenceGCGAGTGCCAAAAAGTAACAA, The corresponding genome sequence is: GCGAGTGCCAAAAAGTAACA.
Please visit https://www.biorxiv.org/content/10.1101/2020.12.18.423517v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_186653 Copy
Species: Drosophila melanogaster
Genetic Insert: OSS Shu N-terminal 3xFlag-3xHA Tag Donor Plasmid
Vector Backbone Description: Vector Backbone:pUC19; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
References:
Comments: Please visit https://www.biorxiv.org/content/10.1101/2020.12.18.423517v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_186655 Copy
Species: Drosophila melanogaster
Genetic Insert: Gle sgRNA Plasmid
Vector Backbone Description: Vector Backbone:pU6-BbsI-chiRNA; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
References:
Comments: sgRNA sequence: GCGTATCCCCTTAACAATAA. The corresponding genome sequence is: CCGTATCCCCTTAACAATAA.
Please visit https://www.biorxiv.org/content/10.1101/2020.12.18.423517v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_186658 Copy
Species: Drosophila melanogaster
Genetic Insert: CG12029
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2536; Vector Backbone:pDONR221; Vector Types:Other, Gateway Donor Vector; Bacterial Resistance:Kanamycin
References:
Comments: Please note that the ORFs in this collection were cloned open-ended (without a stop codon).
Proper citation: RRID:Addgene_34434 Copy
Species: Drosophila melanogaster
Genetic Insert: RhoA
Vector Backbone Description: Backbone Size:11600; Vector Backbone:RCASBP(A); Vector Types:Retroviral, Other, avian expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_14002 Copy
Species: Drosophila melanogaster
Genetic Insert: Drosphila Beta Nu Integrin
Vector Backbone Description: Backbone Size:3000; Vector Backbone:PBluescript II SK-; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_14069 Copy
Species: Drosophila melanogaster
Genetic Insert: anti beta-1 integrin scFv
Vector Backbone Description: Backbone Size:4800; Vector Backbone:pSMBP2; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_159940 Copy
Species: Drosophila melanogaster
Genetic Insert: DmTMEM63
Vector Backbone Description: Backbone Size:5286; Vector Backbone:pIRES2-mCherry; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_136598 Copy
Species: Drosophila melanogaster
Genetic Insert: RhoA
Vector Backbone Description: Backbone Size:11600; Vector Backbone:RCASBP(A); Vector Types:Retroviral, Other, avian expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_13949 Copy
Species: Drosophila melanogaster
Genetic Insert: Hrp48, ADAR
Vector Backbone Description: Vector Backbone:pMT; Vector Types:Bacterial Expression, Insect Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_139685 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.