Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pSC301 Resource Report Resource Website |
RRID:Addgene_31851 | GFP (including ATG start codon) | Hygromycin | PMID:11250077 | Plasmid can also be grown in mycobacteria. | Backbone Marker:Koen De Smet Imperial College Medical School; Backbone Size:5497; Vector Backbone:pSODIT; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin | 2023-09-15 01:10:29 | 0 | ||
|
pSC300 Resource Report Resource Website |
RRID:Addgene_31820 | GFP (lacking ATG start codon) | Hygromycin | PMID:11250077 | Plasmid can also be grown in mycobacteria. | Backbone Marker:Koen De Smet Imperial College Medical School; Backbone Size:5497; Vector Backbone:pSODIT; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin | 2023-09-15 01:10:29 | 0 | ||
|
pML1361 Resource Report Resource Website |
RRID:Addgene_32379 | int Ms6; gfpm2+; xylEm; ttsbiA, ttsbiB | Hygromycin | PMID:20692326 | This is an improved Ms6 integration vector for stable gene integration in mycobacteria with codon optimized gfp and xylE expression as reporter genes; terminators to protect expression cassette against transcriptional interference. Please note that the conserved N->S point mutation found in the Addgene QC sequence of the Ms6 integrase gene is of no consequence and the plasmid is still fully functional for integration. | Vector Backbone:pMl603; Vector Types:Other, bacterial integration vector; Bacterial Resistance:Hygromycin | 2023-09-15 01:10:30 | 0 | ||
|
pML1357 Resource Report Resource Website 1+ mentions |
RRID:Addgene_32378 | int Giles; gfpm2+; xylEm; ttsbiA, ttsbiB | Hygromycin | PMID:20692326 | This is an improved Giles integration vector for stable gene integration in mycobacteria with codon optimized gfp and xylE as reporter genes; terminators to protect expression cassette against transcriptional interference. | Vector Backbone:pML603; Vector Types:Other, bacterial integration vector; Bacterial Resistance:Hygromycin | 2023-09-15 01:10:30 | 1 | ||
|
pDD132 Resource Report Resource Website |
RRID:Addgene_119885 | BbaJ23104_EYFP | Hygromycin | PMID:29366319 | Vector Backbone:p15a; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin | 2023-09-15 01:02:54 | 0 | |||
|
pUV15tetORm Resource Report Resource Website |
RRID:Addgene_17975 | pmyc1tetO-gfp, tetR(B) | Hygromycin | PMID:17483222 | Expresses GFP under control of tetR(B). Also see Pubmed IDs 18059281 and 15687379. pUV15 derivative, Genotype: Hygr, Kmr, pimyc-tetR, pmyc1 tetO-gfp+ | Backbone Size:0; Vector Backbone:pMS2; Vector Types:Other, mycobacteria expression; Bacterial Resistance:Hygromycin | 2023-09-15 01:07:32 | 0 | ||
|
pTE-0X38-GCT6 Resource Report Resource Website |
RRID:Addgene_27057 | P#38-gfp-DAS+4 | synthetic gene | Hygromycin | PMID:21075796 | pTE-mcs derivative (Addgene plasmid# 20320) with GFP-DAS+4 under the control of a strong promoter. DAS+4 sequence is AANDENYSENYADAS at end of GFP. | Backbone Size:6087; Vector Backbone:pTE-0X1-GCT6; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin | 2023-09-15 01:10:09 | 0 | |
|
pYUB1062-GFP Resource Report Resource Website |
RRID:Addgene_117695 | Hygromycin | PMID:30319771 | This is a shuttle vector, designed for expression of the inserted gene in Mycobacterium smegmatis as well as allowing cloning and expressions using E. coli. This plasmid was constructed by Anajana Radhakrishnan from the pYUB1062 vector. pYUB1062 was donated by William R. Jacobs from the Department of Microbiology and Immunology at the Albert Einstein College of Medicine, New York, USA. References: this paper has been accepted in RSC Advances: A GFP-strategy for efficient recombinant protein overexpression and purification in Mycobacterium smegmatis: Anjana Radhakrishnan, Christopher M Furze, Mohd Syed Ahangar, Elizabeth Fullam | Backbone Marker:pYUB1062 was donated by William R. Jacobs from the Department of Microbiology and Immunology at the Albert Einstein; Backbone Size:5800; Vector Backbone:pYUB1062; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin | 2023-09-15 01:02:32 | 0 | |||
|
pVITRO-Fab_Quin-LUCID Resource Report Resource Website |
RRID:Addgene_119049 | Fab_Quin-LUCID_part1 | Synthetic | Hygromycin | PMID:28510347 | Backbone Marker:Invivogen; Backbone Size:6295; Vector Backbone:pVITRO1-Hygro; Vector Types:Mammalian Expression; Bacterial Resistance:Hygromycin | 2023-06-07 01:01:01 | 0 | ||
|
pVITRO-Fab_MTX-LUCID Resource Report Resource Website |
RRID:Addgene_119047 | Fab_MTX-LUCID_part1 | Synthetic | Hygromycin | PMID:28510347 | Backbone Marker:Invivogen; Backbone Size:6295; Vector Backbone:pVITRO1-Hygro; Vector Types:Mammalian Expression; Bacterial Resistance:Hygromycin | 2023-06-07 01:01:01 | 0 | ||
|
pJDC122 Resource Report Resource Website |
RRID:Addgene_157876 | tdTomato | Hygromycin | PMID:26934495 | Vector Backbone:pJDC89; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin | 2024-08-01 01:03:29 | 0 | |||
|
pVITRO1-HAPPID1 Resource Report Resource Website |
RRID:Addgene_204626 | HAPPID1 heavy chain | Homo sapiens | Hygromycin | PMID:37987253 | Backbone Marker:InvivoGen; Backbone Size:6441; Vector Backbone:pVITRO1-hygro-mcs; Vector Types:Mammalian Expression; Bacterial Resistance:Hygromycin | 2023-12-05 12:05:01 | 0 | ||
|
pMST-1313 Resource Report Resource Website |
RRID:Addgene_118076 | pTEF1-cexA-tCYC1 | Other | Hygromycin | PMID:30553933 | Backbone Marker:Matthias Steiger; Vector Backbone:MST606; Vector Types:Yeast Expression; Bacterial Resistance:Hygromycin | 2024-02-27 12:01:08 | 0 | ||
|
pNK7188 Resource Report Resource Website |
RRID:Addgene_219768 | Pv4CL1 | Other | Hygromycin | PMID:38457503 | Backbone Size:4111; Vector Backbone:MoClo adapted pGAPZ-vector with hygromycin resistance; Vector Types:Yeast Expression; Bacterial Resistance:Hygromycin | 2024-08-01 01:07:10 | 0 | ||
|
pJMP3667 Resource Report Resource Website |
RRID:Addgene_222353 | sfGFP | Other | Hygromycin | PMID: | Shuttle vector that replicates in A. baumannii and E. coli; replicates in common cloning strains such as DH10B. | Vector Backbone:p15A and pWH1266; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin | 2024-08-01 01:07:29 | 0 | |
|
pJMP12089 Resource Report Resource Website |
RRID:Addgene_222357 | Hygromycin | PMID: | Tn7 expression vector. | Vector Backbone:R6Kγ; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin | 2024-08-01 01:07:29 | 0 | |||
|
pCap-SG5-Hgy Resource Report Resource Website |
RRID:Addgene_227580 | Hygromycin | PMID:39666857 | Backbone Size:9915; Vector Backbone:pBAC2015, pGM1190, and pUC19; Vector Types:Other; Bacterial Resistance:Hygromycin | 2024-12-18 04:08:13 | 0 | ||||
|
C-5545 ∆cosδε Resource Report Resource Website |
RRID:Addgene_209018 | Deficient in the P2 bacteriophage packaging cos site; rhamnose-inducible P4 delta (δ) and epsilon (ε) genes | Other | Hygromycin | PMID:33317264 | P2 bacteriophage lysogen derived from E. coli EMG C-5545 strain. We designed a pair of primers to check the presence of P2 lysogen in this strain: - P2 gpH C-ter gpG Fw: 5’ GCAGAGCACGAACAGTCACG 3’ - P2 gpH C-ter gpG Rv: 5’ TTATTGCGGCATTTCCGGCC 3’ These primers amplify the C-terminal region of the P2 gpH gene (tail fiber) and the complete gpG gene (tail fiber chaperone) (PCR fragment size: 2070 bp). | Vector Backbone:n/a; Vector Types:; Bacterial Resistance:Hygromycin | 2025-01-18 04:07:44 | 0 | |
|
pMDC32_PbGH3 Resource Report Resource Website |
RRID:Addgene_232335 | PbGH3 | Other | Hygromycin | PMID: | Backbone Marker:Thermo Fisher Scientific; Backbone Size:10141; Vector Backbone:pMDC32; Vector Types:Plant Expression; Bacterial Resistance:Hygromycin | 2025-03-01 01:09:19 | 0 | ||
|
PPE18-ALFA Resource Report Resource Website |
RRID:Addgene_231247 | PPE18-ALFA | Other | Hygromycin | PMID: | Backbone Marker:Bryson Lab; Backbone Size:6512; Vector Backbone:pBB115; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin | 2025-03-05 01:09:05 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
