Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 4 showing 61 ~ 80 out of 5,761 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_12309

    This resource has 1+ mentions.

http://www.addgene.org/12309

Species: Danio rerio
Genetic Insert: Fgf2
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5369; Vector Backbone:pET28b(+); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
References:
Comments:

Proper citation: RRID:Addgene_12309 Copy   


  • RRID:Addgene_120418

    This resource has 1+ mentions.

http://www.addgene.org/120418

Species: Synthetic
Genetic Insert: MutL E32K
Vector Backbone Description: Backbone Marker:The Standard European Vector Architecture (SEVA); http://seva.cnb.csic.es/; Vector Backbone:pSEVA258; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
References:
Comments: Please visit the depositor's website: http://group.szbk.u-szeged.hu/sysbiol/pal-csaba-lab-resources.html for additional information. To view a protocol for using this plasmid, please visit http://group.szbk.u-szeged.hu/sysbiol/EvGEn/resources.html Please visit https://www.biorxiv.org/content/10.1101/495630v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_120418 Copy   


  • RRID:Addgene_120812

    This resource has 1+ mentions.

http://www.addgene.org/120812

Species: Synthetic
Genetic Insert: red fluorescent protein (mCherry), codon-optimized for C. difficile
Vector Backbone Description: Backbone Size:6400; Vector Backbone:pRFP185; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
References:
Comments:

Proper citation: RRID:Addgene_120812 Copy   


http://www.addgene.org/120805

Species: Synthetic
Genetic Insert: rsCaMPARI
Vector Backbone Description: Backbone Size:4270; Vector Backbone:pAAV; Vector Types:AAV; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_120805 Copy   


  • RRID:Addgene_120882

    This resource has 1+ mentions.

http://www.addgene.org/120882

Species: Synthetic
Genetic Insert: Cas12i1
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5349; Vector Backbone:pET-28a+; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Kanamycin
References:
Comments: For more information, please visit us at https://arbor.bio/. For commercial use or questions, please contact us at inquiries@arbor.bio. mH6 sequence: ATGAAAATCGAAGAAGGTAAAGGTCACCATCACCATCACCAC

Proper citation: RRID:Addgene_120882 Copy   


  • RRID:Addgene_121154

    This resource has 1+ mentions.

http://www.addgene.org/121154

Species: Homo sapiens
Genetic Insert: Ubiquitin C
Vector Backbone Description: Backbone Marker:Ted Dawson, Addgene plasmid #17608; Vector Backbone:pRK5-HA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_121154 Copy   


  • RRID:Addgene_126206

    This resource has 1+ mentions.

http://www.addgene.org/126206

Species:
Genetic Insert: Green Glifon50
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pcDNA3.1(-); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_126206 Copy   


  • RRID:Addgene_126208

    This resource has 1+ mentions.

http://www.addgene.org/126208

Species:
Genetic Insert: Green Glifon4000
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pcDNA3.1(-); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_126208 Copy   


  • RRID:Addgene_12645

    This resource has 1+ mentions.

http://www.addgene.org/12645

Species: Homo sapiens
Genetic Insert: E3-Ring domain, Ub-ligase
Vector Backbone Description: Backbone Marker:invitrogen; Backbone Size:4500; Vector Backbone:pET151D topo; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_12645 Copy   


  • RRID:Addgene_12647

    This resource has 1+ mentions.

http://www.addgene.org/12647

Species: Homo sapiens
Genetic Insert: Ubiquitin - wild type
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5000; Vector Backbone:pET15; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments: This plasmid contains a 76 amino acid synthetic ubiquitin insert used to determine the 3D structure of the UbcH5c/Ub noncovalent complex, as described in the associated publication.

Proper citation: RRID:Addgene_12647 Copy   


  • RRID:Addgene_12679

    This resource has 1+ mentions.

http://www.addgene.org/12679

Species: Homo sapiens
Genetic Insert: RAB11A (Homo sapiens)
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pDsRed-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments:

Proper citation: RRID:Addgene_12679 Copy   


  • RRID:Addgene_119775

    This resource has 1+ mentions.

http://www.addgene.org/119775

Species: Other
Genetic Insert: AtU6-SmR-sgRNA
Vector Backbone Description: Backbone Size:3152; Vector Backbone:pUC57; Vector Types:Plant Expression; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_119775 Copy   


  • RRID:Addgene_119768

    This resource has 1+ mentions.

http://www.addgene.org/119768

Species: Other
Genetic Insert: APOBEC3A-nCas9-NLS-UGI-NLS
Vector Backbone Description: Backbone Size:4919; Vector Backbone:pJIT163; Vector Types:Plant Expression; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_119768 Copy   


  • RRID:Addgene_11978

    This resource has 1+ mentions.

http://www.addgene.org/11978

Species: Homo sapiens
Genetic Insert: MKL1
Vector Backbone Description: Backbone Marker:Sigma; Backbone Size:4700; Vector Backbone:pCMV-3xFLAG-7.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_11978 Copy   


  • RRID:Addgene_120168

    This resource has 1+ mentions.

http://www.addgene.org/120168

Species: Mus musculus
Genetic Insert: BICD cargo adaptor 2
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4713; Vector Backbone:pmCherry-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments:

Proper citation: RRID:Addgene_120168 Copy   


  • RRID:Addgene_107424

    This resource has 1+ mentions.

http://www.addgene.org/107424

Species: Rattus norvegicus
Genetic Insert: calcium channel beta2a auxillary subunit
Vector Backbone Description: Backbone Size:5163; Vector Backbone:pMT2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: We received it in pBluescript and subcloned it into pMT2 plasmid.

Proper citation: RRID:Addgene_107424 Copy   


  • RRID:Addgene_78578

    This resource has 1+ mentions.

http://www.addgene.org/78578

Species: Rattus norvegicus
Genetic Insert: vGAT-pHluorin C-term
Vector Backbone Description: Backbone Size:4790; Vector Backbone:pCAGGS E/S; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_78578 Copy   


  • RRID:Addgene_71728

    This resource has 1+ mentions.

http://www.addgene.org/71728

Species: Saccharomyces cerevisiae
Genetic Insert: Gal4 DBD(1-147)
Vector Backbone Description: Backbone Size:2924; Vector Backbone:pECE; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_71728 Copy   


  • RRID:Addgene_38001

    This resource has 1+ mentions.

http://www.addgene.org/38001

Species: Homo sapiens
Genetic Insert: FKBP1A
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pmRFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments: Compared to GenBank reference sequence NM_019892, the INPP5E insert in this plasmid contains a C641A mutation. Please see the full plasmid sequence for the most accurate information.

Proper citation: RRID:Addgene_38001 Copy   


  • RRID:Addgene_38000

    This resource has 1+ mentions.

http://www.addgene.org/38000

Species: Homo sapiens
Genetic Insert: FKBP1A
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pmRFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments: Compared to GenBank reference sequence NM_019892, the INPP5E insert in this plasmid contains a C641A mutation. Please see the full plasmid sequence for the most accurate information.

Proper citation: RRID:Addgene_38000 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. Neuroscience Information Framework Resources

    Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within NIF that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X