Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Bacterial Resistance:gentamicin (facet)


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

693 Results - per page

Show More Columns | Download 693 Result(s)

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
pKM377
 
Resource Report
Resource Website
RRID:Addgene_134210 CENP-H/K/M untagged + his-I Homo sapiens Gentamicin PMID:26698661 Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin 2023-04-01 01:02:19 0
pKM394
 
Resource Report
Resource Website
RRID:Addgene_134211 CENP-N-his-CENP-L Homo sapiens Gentamicin PMID:26698661 Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin 2023-04-01 01:02:19 0
pKM634
 
Resource Report
Resource Website
RRID:Addgene_134219 CENP HIKM Homo sapiens Gentamicin PMID:26698661 Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin 2023-04-01 01:02:20 0
pEN_TTmiRC2_3xflag_Luciferase
 
Resource Report
Resource Website
RRID:Addgene_136519 Luciferase Gentamicin PMID:32291314 Backbone Marker:Addgene #25752; Backbone Size:4422; Vector Backbone:pEN_TTmiRc2; Vector Types:Other, entry vector for gateway cloning; Bacterial Resistance:Gentamicin 2023-04-01 01:02:27 0
pCas3cRh
 
Resource Report
Resource Website
RRID:Addgene_133773 RhaR Gentamicin PMID:33077967 Please note: Plasmid contains a K244R mutation in pRO1600 Rep. This mutation is not known to affect plasmid function. Backbone Marker:Dongru Qiu, Hongwei D. Yu; Backbone Size:5216; Vector Backbone:pHERD30T; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin 2023-04-01 01:02:18 0
pDD143
 
Resource Report
Resource Website
RRID:Addgene_119880 pBAD_dCas9sth1 Gentamicin PMID:29366319 Vector Backbone:pAL5000/pMB1 shuttle vector; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin 2023-04-01 01:01:24 0
pDONR207 SARS-CoV-2 E
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_141273 E Other Gentamicin PMID:32763951 Backbone Marker:Invitrogen; Backbone Size:5585; Vector Backbone:pDONR207; Vector Types:Other, Gateway-compatible Entry vector; Bacterial Resistance:Gentamicin Many synonymous changes due to codon optimization 2023-04-01 01:02:44 1
pKM672
 
Resource Report
Resource Website
RRID:Addgene_134221 GST-CENP-C 1-509 Homo sapiens Gentamicin PMID:26698661 Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin 2023-04-01 01:02:20 0
pDONR207 SARS-CoV-2 ORF7A
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_141276 ORF7A Other Gentamicin PMID:32763951 Backbone Marker:Invitrogen; Backbone Size:5585; Vector Backbone:pDONR207; Vector Types:Other, Gateway-compatible Entry vector; Bacterial Resistance:Gentamicin Many synonymous changes due to codon optimization 2023-04-01 01:02:44 1
pKM673
 
Resource Report
Resource Website
RRID:Addgene_134222 GST-CENP-C 510-end Homo sapiens Gentamicin PMID:26698661 Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin 2023-04-01 01:02:20 0
pEN_TTmiRc2_BirA
 
Resource Report
Resource Website
RRID:Addgene_136521 BirA Other Gentamicin PMID:32291314 Backbone Marker:Addgene #25752; Backbone Size:4422; Vector Backbone:pEN_TTmiRc2; Vector Types:Other, entry vector for gateway cloning; Bacterial Resistance:Gentamicin R118G (highly promiscuous form) 2023-04-01 01:02:28 0
pEN_TTmiRC2_3xflag_NRF2(RR)
 
Resource Report
Resource Website
RRID:Addgene_136522 NRF2(1584A>C,1586A>T,1589A>G) Homo sapiens Gentamicin PMID:32291314 Backbone Marker:Addgene #83274; Backbone Size:4422; Vector Backbone:pEN_TT miRc2 3xFLAG; Vector Types:Other, entry vector for gateway cloning; Bacterial Resistance:Gentamicin This plasmid is developed by mutating 3 base pairs within the sequence targeted by shNRF2 version 1 (c.1584A>C,c.1586A>T,c.1589A>G) of NRF2 sequence in the pEN_TTmiRc2_3xflag_NRF2 plasmid using QuickChange II XL site-directed mutagenesis kit to create an RNAi-resistant version of NRF2. These base pair changes do not change the amino acid sequence, but switch the codons to rare codons in the human genome. Primer used: ctggaaaatatagtagaactagagcaagatttcgttcgtttgaaagatgaaaaagaaaaattgctcaaa 2023-04-01 01:02:28 0
pKM692
 
Resource Report
Resource Website
RRID:Addgene_134224 GST-CENP-C 235-509 Homo sapiens Gentamicin PMID:26698661 Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin 2023-04-01 01:02:20 0
pEN_TTmiRc2_p53(R280K)_V5
 
Resource Report
Resource Website
RRID:Addgene_136525 p53(R280K) Homo sapiens Gentamicin PMID:32291314 Backbone Marker:Addgene #25752; Backbone Size:4422; Vector Backbone:pEN_TTmiRc2; Vector Types:Other, entry vector for gateway cloning; Bacterial Resistance:Gentamicin p53(R280K)V5 was cloned from pLenti6-p53-R280K-V5 plasmid from Addgene (plasmid #22933) with SpeI and MfeI 5' and 3' sites, respectively. There is a C --> G polymorphism at base pair 215 in ORF (corresponding to codon 72- switching from a proline to an arginine). This base pair substitution was encoded in the insert in the pLenti6 plasmid obtained from Addgene and is a common sequence polymorphism observed in p53. 2023-04-01 01:02:28 0
pEN_TTmiRc2_3xflag_NRF2
 
Resource Report
Resource Website
RRID:Addgene_136527 NRF2 Homo sapiens Gentamicin PMID:32291314 Backbone Marker:Addgene #83274; Backbone Size:4496; Vector Backbone:pEN_TT miRc2 3xFLAG; Vector Types:Other, entry vector for gateway cloning; Bacterial Resistance:Gentamicin 2023-04-01 01:02:28 0
pORTMAGE502B
 
Resource Report
Resource Website
RRID:Addgene_128971 PapRecT Other Gentamicin PMID: Backbone Size:4000; Vector Backbone:pSEVA258; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin 2023-04-01 01:02:00 0
MOM603
 
Resource Report
Resource Website
RRID:Addgene_133242 kif1a Homo sapiens Gentamicin PMID:31455732 Vector Backbone:pAcebac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin 2023-04-01 01:02:16 0
pBSV2G_P0826-BB0323-mCherryBb
 
Resource Report
Resource Website
RRID:Addgene_118244 BB0323-mCherry translational fusion under the control of the bb0826 promoter Synthetic Gentamicin PMID:30315081 Please visit https://www.biorxiv.org/content/early/2018/09/21/363390 for bioRxiv preprint. Vector Backbone:pBSV2G_2; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin 2023-04-01 01:01:20 0
pBSV2G_PflaB-iRFPBb
 
Resource Report
Resource Website
RRID:Addgene_118237 flagellin promoter driven iRFP Synthetic Gentamicin PMID:30315081 Please visit https://www.biorxiv.org/content/early/2018/09/21/363390 for bioRxiv preprint. Vector Backbone:pBSV2G_2; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin 2023-04-01 01:01:20 0
DYNLRB1
 
Resource Report
Resource Website
RRID:Addgene_132533 DYNLRB1 Homo sapiens Gentamicin PMID:31451806 Cloned by Ruta Zalyte in Andrew Carter's lab. For cloning strategy, please refer to the Methods section of Toropova et al 2019. Backbone Marker:Geneva Biotech; Backbone Size:2922; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin Codon optimised for Sf9 expression 2023-04-01 01:02:14 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. Neuroscience Information Framework Resources

    Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.