Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pKM377 Resource Report Resource Website |
RRID:Addgene_134210 | CENP-H/K/M untagged + his-I | Homo sapiens | Gentamicin | PMID:26698661 | Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin | 2023-04-01 01:02:19 | 0 | ||
|
pKM394 Resource Report Resource Website |
RRID:Addgene_134211 | CENP-N-his-CENP-L | Homo sapiens | Gentamicin | PMID:26698661 | Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin | 2023-04-01 01:02:19 | 0 | ||
|
pKM634 Resource Report Resource Website |
RRID:Addgene_134219 | CENP HIKM | Homo sapiens | Gentamicin | PMID:26698661 | Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin | 2023-04-01 01:02:20 | 0 | ||
|
pEN_TTmiRC2_3xflag_Luciferase Resource Report Resource Website |
RRID:Addgene_136519 | Luciferase | Gentamicin | PMID:32291314 | Backbone Marker:Addgene #25752; Backbone Size:4422; Vector Backbone:pEN_TTmiRc2; Vector Types:Other, entry vector for gateway cloning; Bacterial Resistance:Gentamicin | 2023-04-01 01:02:27 | 0 | |||
|
pCas3cRh Resource Report Resource Website |
RRID:Addgene_133773 | RhaR | Gentamicin | PMID:33077967 | Please note: Plasmid contains a K244R mutation in pRO1600 Rep. This mutation is not known to affect plasmid function. | Backbone Marker:Dongru Qiu, Hongwei D. Yu; Backbone Size:5216; Vector Backbone:pHERD30T; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin | 2023-04-01 01:02:18 | 0 | ||
|
pDD143 Resource Report Resource Website |
RRID:Addgene_119880 | pBAD_dCas9sth1 | Gentamicin | PMID:29366319 | Vector Backbone:pAL5000/pMB1 shuttle vector; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin | 2023-04-01 01:01:24 | 0 | |||
|
pDONR207 SARS-CoV-2 E Resource Report Resource Website 1+ mentions |
RRID:Addgene_141273 | E | Other | Gentamicin | PMID:32763951 | Backbone Marker:Invitrogen; Backbone Size:5585; Vector Backbone:pDONR207; Vector Types:Other, Gateway-compatible Entry vector; Bacterial Resistance:Gentamicin | Many synonymous changes due to codon optimization | 2023-04-01 01:02:44 | 1 | |
|
pKM672 Resource Report Resource Website |
RRID:Addgene_134221 | GST-CENP-C 1-509 | Homo sapiens | Gentamicin | PMID:26698661 | Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin | 2023-04-01 01:02:20 | 0 | ||
|
pDONR207 SARS-CoV-2 ORF7A Resource Report Resource Website 1+ mentions |
RRID:Addgene_141276 | ORF7A | Other | Gentamicin | PMID:32763951 | Backbone Marker:Invitrogen; Backbone Size:5585; Vector Backbone:pDONR207; Vector Types:Other, Gateway-compatible Entry vector; Bacterial Resistance:Gentamicin | Many synonymous changes due to codon optimization | 2023-04-01 01:02:44 | 1 | |
|
pKM673 Resource Report Resource Website |
RRID:Addgene_134222 | GST-CENP-C 510-end | Homo sapiens | Gentamicin | PMID:26698661 | Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin | 2023-04-01 01:02:20 | 0 | ||
|
pEN_TTmiRc2_BirA Resource Report Resource Website |
RRID:Addgene_136521 | BirA | Other | Gentamicin | PMID:32291314 | Backbone Marker:Addgene #25752; Backbone Size:4422; Vector Backbone:pEN_TTmiRc2; Vector Types:Other, entry vector for gateway cloning; Bacterial Resistance:Gentamicin | R118G (highly promiscuous form) | 2023-04-01 01:02:28 | 0 | |
|
pEN_TTmiRC2_3xflag_NRF2(RR) Resource Report Resource Website |
RRID:Addgene_136522 | NRF2(1584A>C,1586A>T,1589A>G) | Homo sapiens | Gentamicin | PMID:32291314 | Backbone Marker:Addgene #83274; Backbone Size:4422; Vector Backbone:pEN_TT miRc2 3xFLAG; Vector Types:Other, entry vector for gateway cloning; Bacterial Resistance:Gentamicin | This plasmid is developed by mutating 3 base pairs within the sequence targeted by shNRF2 version 1 (c.1584A>C,c.1586A>T,c.1589A>G) of NRF2 sequence in the pEN_TTmiRc2_3xflag_NRF2 plasmid using QuickChange II XL site-directed mutagenesis kit to create an RNAi-resistant version of NRF2. These base pair changes do not change the amino acid sequence, but switch the codons to rare codons in the human genome. Primer used: ctggaaaatatagtagaactagagcaagatttcgttcgtttgaaagatgaaaaagaaaaattgctcaaa | 2023-04-01 01:02:28 | 0 | |
|
pKM692 Resource Report Resource Website |
RRID:Addgene_134224 | GST-CENP-C 235-509 | Homo sapiens | Gentamicin | PMID:26698661 | Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin | 2023-04-01 01:02:20 | 0 | ||
|
pEN_TTmiRc2_p53(R280K)_V5 Resource Report Resource Website |
RRID:Addgene_136525 | p53(R280K) | Homo sapiens | Gentamicin | PMID:32291314 | Backbone Marker:Addgene #25752; Backbone Size:4422; Vector Backbone:pEN_TTmiRc2; Vector Types:Other, entry vector for gateway cloning; Bacterial Resistance:Gentamicin | p53(R280K)V5 was cloned from pLenti6-p53-R280K-V5 plasmid from Addgene (plasmid #22933) with SpeI and MfeI 5' and 3' sites, respectively. There is a C --> G polymorphism at base pair 215 in ORF (corresponding to codon 72- switching from a proline to an arginine). This base pair substitution was encoded in the insert in the pLenti6 plasmid obtained from Addgene and is a common sequence polymorphism observed in p53. | 2023-04-01 01:02:28 | 0 | |
|
pEN_TTmiRc2_3xflag_NRF2 Resource Report Resource Website |
RRID:Addgene_136527 | NRF2 | Homo sapiens | Gentamicin | PMID:32291314 | Backbone Marker:Addgene #83274; Backbone Size:4496; Vector Backbone:pEN_TT miRc2 3xFLAG; Vector Types:Other, entry vector for gateway cloning; Bacterial Resistance:Gentamicin | 2023-04-01 01:02:28 | 0 | ||
|
pORTMAGE502B Resource Report Resource Website |
RRID:Addgene_128971 | PapRecT | Other | Gentamicin | PMID: | Backbone Size:4000; Vector Backbone:pSEVA258; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin | 2023-04-01 01:02:00 | 0 | ||
|
MOM603 Resource Report Resource Website |
RRID:Addgene_133242 | kif1a | Homo sapiens | Gentamicin | PMID:31455732 | Vector Backbone:pAcebac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin | 2023-04-01 01:02:16 | 0 | ||
|
pBSV2G_P0826-BB0323-mCherryBb Resource Report Resource Website |
RRID:Addgene_118244 | BB0323-mCherry translational fusion under the control of the bb0826 promoter | Synthetic | Gentamicin | PMID:30315081 | Please visit https://www.biorxiv.org/content/early/2018/09/21/363390 for bioRxiv preprint. | Vector Backbone:pBSV2G_2; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin | 2023-04-01 01:01:20 | 0 | |
|
pBSV2G_PflaB-iRFPBb Resource Report Resource Website |
RRID:Addgene_118237 | flagellin promoter driven iRFP | Synthetic | Gentamicin | PMID:30315081 | Please visit https://www.biorxiv.org/content/early/2018/09/21/363390 for bioRxiv preprint. | Vector Backbone:pBSV2G_2; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin | 2023-04-01 01:01:20 | 0 | |
|
DYNLRB1 Resource Report Resource Website |
RRID:Addgene_132533 | DYNLRB1 | Homo sapiens | Gentamicin | PMID:31451806 | Cloned by Ruta Zalyte in Andrew Carter's lab. For cloning strategy, please refer to the Methods section of Toropova et al 2019. | Backbone Marker:Geneva Biotech; Backbone Size:2922; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin | Codon optimised for Sf9 expression | 2023-04-01 01:02:14 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
