Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Organism:danio rerio (facet)


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

2,111 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
p5E-kdrl
 
Resource Report
Resource Website
RRID:Addgene_78687 kdrl promoter Danio rerio Kanamycin PMID:17306248 Backbone Marker:Invitrogen; Backbone Size:2600; Vector Backbone:pDONRp4p1r; Vector Types:Unspecified; Bacterial Resistance:Kanamycin 2022-11-11 12:19:21 0
pDONR221-ets2
 
Resource Report
Resource Website
RRID:Addgene_192724 ets2 Danio rerio Kanamycin PMID: cDNA encodes NP_001018874.1; homolog of human ETS2 Backbone Marker:Invitrogen; Vector Backbone:pDONR221; Vector Types:Other, Gateway Entry Vector; Bacterial Resistance:Kanamycin N189D (rs502796915); S231N 2022-11-16 12:18:10 0
pDONR221-get1
 
Resource Report
Resource Website
RRID:Addgene_192722 get1 Danio rerio Kanamycin PMID: cDNA encodes NP_001003413.1; homolog of human GET1 Backbone Marker:Invitrogen; Vector Backbone:pDONR221; Vector Types:Other, Gateway Entry Vector; Bacterial Resistance:Kanamycin 2022-11-16 12:19:10 0
pDONR221-kcnj6
 
Resource Report
Resource Website
RRID:Addgene_192725 kcnj6 Danio rerio Kanamycin PMID: cDNA encodes homolog of human KCNJ6 Backbone Marker:Invitrogen; Vector Backbone:pDONR221; Vector Types:Other, Gateway Entry Vector; Bacterial Resistance:Kanamycin 5' insertion of ATGGCCAAGCTGACAGAATCC, identical to human KCNJ6 2022-11-16 12:03:50 0
pDONR221-si:ch73-281n10.2
 
Resource Report
Resource Website
RRID:Addgene_192716 si:ch73-281n10.2 Danio rerio Kanamycin PMID: cDNA encodes NP_001296573.1; homolog of human HMGN1 Backbone Marker:Invitrogen; Vector Backbone:pDONR221; Vector Types:Other, Gateway Entry Vector; Bacterial Resistance:Kanamycin 2022-11-16 12:18:10 0
pENTR5'_ubi
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_27320 zebrafish ubiquitin promoter Danio rerio Kanamycin PMID:21138979 Backbone Marker:Invitrogen; Backbone Size:2692; Vector Backbone:pENTR5' TOPO; Vector Types:Other, Multisite Gateway 5' entry vector; Bacterial Resistance:Kanamycin 2022-12-18 12:04:50 3
p3E_he1a:mCherry
 
Resource Report
Resource Website
RRID:Addgene_113881 he1a Danio rerio Kanamycin PMID: Cloned from the construct provided by Jeff Mumm's Lab, pTol2 5xUAS:mRFP-NTRmut;HE-mCherry Reference for the he1a promoter was first described in: Xie et al., "Silencer-delimited transgenesis: NRSE/RE1 sequences promote neural-specific transgene expression in a NRSF/REST-dependent manner​." BMC Biology 2012 10:93 https://doi.org/10.1186/1741-7007-10-93 Backbone Marker:Invitrogen; Backbone Size:2640; Vector Backbone:pDONR P2R-P3; Vector Types:Other, Zebrafish Danio expression; Bacterial Resistance:Kanamycin 2022-04-22 03:18:26 0
pCRII-TOPO-ZFERV
 
Resource Report
Resource Website
RRID:Addgene_11192 ZFERV Danio rerio Ampicillin PMID:14694121 ZFERV PCR insert (the single 3' A overhangs on both ends are not included): 5'-TCTAAAGGAAAATGAACTTAACAGTTGCGAG (31 nt total upstream of the ZFERV sequence), CGAGgacaac agtggaatgg aatctttgtt aaatttagca aagtacagta aactgaacag agtattgcga ata -3' (73 nt total downstream of the ZFERV sequence). A map of pCRII-TOPO is available at Addgene's vector DB. Backbone Marker:Invitrogen; Backbone Size:3950; Vector Backbone:pCRII-TOPO; Vector Types:Other, Zebrafish; Bacterial Resistance:Ampicillin 2022-04-22 03:17:58 0
MiniCoopR U6:gRNA spred1, mitfa:Cas9
 
Resource Report
Resource Website
RRID:Addgene_118843 spred1 gRNA Danio rerio Ampicillin PMID:30385465 Vector Backbone:MiniCoopR; Vector Types:CRISPR, Other, Tol2; Bacterial Resistance:Ampicillin 2022-04-22 03:20:01 0
MiniCoopR U6:gRNA cdkn2a, mitfa:Cas9
 
Resource Report
Resource Website
RRID:Addgene_118842 cdkn2a gRNA Danio rerio Ampicillin PMID:30385465 Vector Backbone:MiniCoopR; Vector Types:CRISPR, Other, Tol2; Bacterial Resistance:Ampicillin 2022-04-22 03:20:01 0
MiniCoopR 2xU6:gRNA pten, mitfa:Cas9
 
Resource Report
Resource Website
RRID:Addgene_118845 ptena and ptenb Danio rerio Ampicillin PMID:30385465 Vector Backbone:MiniCoopR; Vector Types:CRISPR, Other, Tol2; Bacterial Resistance:Ampicillin 2022-04-22 03:20:01 0
rag1 long
 
Resource Report
Resource Website
RRID:Addgene_11299 rag1 Danio rerio Ampicillin PMID:9089097 Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBluescript KS(-); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2022-04-22 03:18:11 0
rag1 short
 
Resource Report
Resource Website
RRID:Addgene_11300 rag1 Danio rerio Ampicillin PMID:9089097 This is a rag1 PCR product. To make probes: antisense HindIII - T7, sense XbaI - T3. Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBluescript KS(-); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2022-04-22 03:18:11 0
p5E-1.7kbfabp6
 
Resource Report
Resource Website
RRID:Addgene_159087 1.7kb fabp6 promoter Danio rerio Kanamycin PMID:34301599 Backbone Marker:tol2kit; Vector Backbone:p5E-Fse-Asc entry vector; Vector Types:Other, promoter fragment 5' entry vector for tol2 cloning; Bacterial Resistance:Kanamycin 2022-10-07 04:37:43 0
pDONR221-appa
 
Resource Report
Resource Website
RRID:Addgene_192745 appa Danio rerio Kanamycin PMID: cDNA encodes AFN73054.1; homolog of human APP Backbone Marker:Invitrogen; Vector Backbone:pDONR221; Vector Types:Other, Gateway Entry Vector; Bacterial Resistance:Kanamycin S47N 2022-11-23 12:03:00 0
pTwist-ENTR-rbm11-202
 
Resource Report
Resource Website
RRID:Addgene_192729 rbm11 Danio rerio Kanamycin PMID: cDNA encodes rbm11-202; homolog of human RBM11 Backbone Marker:Twist Bioscience; Vector Backbone:pTwist ENTR Kozak; Vector Types:Other, Gateway Entry Vector; Bacterial Resistance:Kanamycin 2022-11-23 12:16:19 0
pDONR221-nrip1a
 
Resource Report
Resource Website
RRID:Addgene_192731 nrip1a Danio rerio Kanamycin PMID: cDNA encodes XP_005157806.1; homolog of human NRIP1 Backbone Marker:Invitrogen; Vector Backbone:pDONR221; Vector Types:Other, Gateway Entry Vector; Bacterial Resistance:Kanamycin E662Q; S895P; H967Q 2022-11-23 12:03:00 0
pDONR221-btg3
 
Resource Report
Resource Website
RRID:Addgene_192735 btg3 Danio rerio Kanamycin PMID: cDNA encodes NP_001313635.1; homolog of human BTG3 Backbone Marker:Invitrogen; Vector Backbone:pDONR221; Vector Types:Other, Gateway Entry Vector; Bacterial Resistance:Kanamycin H211Y 2022-11-23 12:03:00 0
pDONR221-cxadr
 
Resource Report
Resource Website
RRID:Addgene_192734 cxadr Danio rerio Kanamycin PMID: cDNA encodes NP_694480.1; homolog of human CXADR Backbone Marker:Invitrogen; Vector Backbone:pDONR221; Vector Types:Other, Gateway Entry Vector; Bacterial Resistance:Kanamycin 2022-11-23 12:03:00 0
pDONR221-ncam2
 
Resource Report
Resource Website
RRID:Addgene_192739 ncam2 Danio rerio Kanamycin PMID: cDNA encodes NP_571905.1; homolog of human NCAM2 Backbone Marker:Invitrogen; Vector Backbone:pDONR221; Vector Types:Other, Gateway Entry Vector; Bacterial Resistance:Kanamycin 2022-11-23 12:03:00 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. Neuroscience Information Framework Resources

    Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.