Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species:
Genetic Insert:
Vector Backbone Description: Backbone Size:999; Vector Backbone:R6k; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments: Please visit https://www.biorxiv.org/content/10.1101/2023.03.03.531003v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_199652 Copy
Species: Mus musculus
Genetic Insert: Tet1-ZF_CD
Vector Backbone Description: Backbone Marker:our lab; Backbone Size:5924; Vector Backbone:pCAG-mcherry-Tet1CD pc2547; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_201709 Copy
Species: Synthetic
Genetic Insert: CAST I-F systems
Vector Backbone Description: Backbone Size:12736; Vector Backbone:R6k; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments: Please visit https://www.biorxiv.org/content/10.1101/2023.03.03.531003v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_199653 Copy
Species:
Genetic Insert:
Vector Backbone Description: Backbone Marker:Herbert Schweizer; Backbone Size:4356; Vector Backbone:pUC18R6KT-mini-Tn7T-Km; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments: Ec100D pir-116 genotype:
F- mcrA Δ(mrr-hsdRMS-mcrBC) ϕ80dlacZΔM15 ΔlacX74 recA1 endA1 araD139 Δ(ara, leu)7697 galU galK λ- rpsL nupG pir-116(DHRF) Maintains plasmids at ~250 copies per cell.
This strain is naturally resistant to streptomycin
Proper citation: RRID:Addgene_200989 Copy
Species:
Genetic Insert:
Vector Backbone Description: Backbone Marker:Philip Poole lab; Backbone Size:5262; Vector Backbone:pTn7-SCOUT10; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin
References:
Comments: Ec100D pir-116 genotype:
F- mcrA Δ(mrr-hsdRMS-mcrBC) ϕ80dlacZΔM15 ΔlacX74 recA1 endA1 araD139 Δ(ara, leu)7697 galU galK λ- rpsL nupG pir-116(DHRF) Maintains plasmids at ~250 copies per cell.
This strain is naturally resistant to streptomycin
Proper citation: RRID:Addgene_200992 Copy
Species:
Genetic Insert:
Vector Backbone Description: Backbone Marker:Philip Poole lab; Backbone Size:5565; Vector Backbone:pTn7-SCOUT20; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin
References:
Comments: Ec100D pir-116 genotype:
F- mcrA Δ(mrr-hsdRMS-mcrBC) ϕ80dlacZΔM15 ΔlacX74 recA1 endA1 araD139 Δ(ara, leu)7697 galU galK λ- rpsL nupG pir-116(DHRF) Maintains plasmids at ~250 copies per cell.
This strain is naturally resistant to streptomycin
Proper citation: RRID:Addgene_200996 Copy
Species:
Genetic Insert:
Vector Backbone Description: Backbone Marker:Philip Poole lab; Backbone Size:6696; Vector Backbone:pTn7-SCOUT20; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Tetracycline
References:
Comments: Ec100D pir-116 genotype:
F- mcrA Δ(mrr-hsdRMS-mcrBC) ϕ80dlacZΔM15 ΔlacX74 recA1 endA1 araD139 Δ(ara, leu)7697 galU galK λ- rpsL nupG pir-116(DHRF) Maintains plasmids at ~250 copies per cell.
This strain is naturally resistant to streptomycin
Proper citation: RRID:Addgene_200997 Copy
Species:
Genetic Insert:
Vector Backbone Description: Backbone Marker:Philip Poole lab; Backbone Size:5556; Vector Backbone:pTn7-SCOUT20; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Spectinomycin
References:
Comments: Ec100D pir-116 genotype:
F- mcrA Δ(mrr-hsdRMS-mcrBC) ϕ80dlacZΔM15 ΔlacX74 recA1 endA1 araD139 Δ(ara, leu)7697 galU galK λ- rpsL nupG pir-116(DHRF) Maintains plasmids at ~250 copies per cell.
This strain is naturally resistant to streptomycin
Proper citation: RRID:Addgene_200998 Copy
Species:
Genetic Insert:
Vector Backbone Description: Backbone Marker:Philip Poole lab; Backbone Size:4659; Vector Backbone:pTn7-SCOUT10; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments: Ec100D pir-116 genotype:
F- mcrA Δ(mrr-hsdRMS-mcrBC) ϕ80dlacZΔM15 ΔlacX74 recA1 endA1 araD139 Δ(ara, leu)7697 galU galK λ- rpsL nupG pir-116(DHRF) Maintains plasmids at ~250 copies per cell.
This strain is naturally resistant to streptomycin
Proper citation: RRID:Addgene_200990 Copy
Species:
Genetic Insert: GPI
Vector Backbone Description: Backbone Size:8542; Vector Backbone:pBSK; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
References:
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.09.21.461278v4 for bioRxiv preprint.
Please note: This plasmid contains a single nucleotide mutation in YFP second half and has CD58 and C. elegans strain Bristol N2 chromosome II sequences instead of UNC-54 3'UTR. These differences are not known to affect plasmid function.
Proper citation: RRID:Addgene_199631 Copy
Species: Mus musculus
Genetic Insert: VprBP
Vector Backbone Description: Backbone Size:8297; Vector Backbone:GFP-TDG (pc2422); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_201698 Copy
Species: Other
Genetic Insert: E. coli AlkB
Vector Backbone Description: Backbone Size:5295; Vector Backbone:pET-28a(+); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_160433 Copy
Species: Other
Genetic Insert: 35s
Vector Backbone Description: Backbone Marker:self-made; derived from pGEMT-Easy manufactured by Promega; Vector Backbone:pUPD; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin
References:
Comments: Compatible with GoldenBraid; insert can be released with BsaI
Proper citation: RRID:Addgene_160554 Copy
Species: Other
Genetic Insert: E. coli AlkB
Vector Backbone Description: Backbone Size:5295; Vector Backbone:pET-28a(+); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_160434 Copy
Species: Mus musculus
Genetic Insert: tandem HRS FYVE domain
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C3; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_140047 Copy
Species: Synthetic
Genetic Insert: Con/Fon-ChRmine-p2a-oScarlet
Vector Backbone Description: Backbone Size:4600; Vector Backbone:AAV2-nEF-WPRE; Vector Types:AAV, Cre/Lox, Synthetic Biology, Flp/FRT; Bacterial Resistance:Ampicillin
References:
Comments: Additional sequencing primers: Intron 2F GGGACGACATGACTTAACCAG; Intron 2R CCAGCCCTTCTCATGTTCAG; Intron 1F CCTGTATGTGACCCATGTGC; Intron 1R: GCACATGGGTCACATACAGG
Proper citation: RRID:Addgene_137159 Copy
Species: Homo sapiens
Genetic Insert: Abeta(MC1-42)
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pET vector; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_127151 Copy
Species: Homo sapiens
Genetic Insert: SLC17A1
Vector Backbone Description: Backbone Marker:Thermo Fisher Scientific; Backbone Size:2550; Vector Backbone:pDONR221; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments: For more information on the full Resolute plasmid collection, please see www.addgene.org/depositor-collections/re-solute/. Please provide your feedback on this plasmid to the RESOLUTE consortium by filling out their RESOLUTE repository feedback form: https://forms.office.com/Pages/ResponsePage.aspx?id=0e05yklzmkS7rjFGQL4N7z4feCLQvEJAmVcOCM_u885UN1JJRko0Ukg4TVQwNTZLOUxPQVJWT1NHUCQlQCN0PWcu
Proper citation: RRID:Addgene_131888 Copy
Species: Homo sapiens
Genetic Insert: SLC7A14
Vector Backbone Description: Backbone Marker:Thermo Fisher Scientific; Backbone Size:2550; Vector Backbone:pDONR221; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments: For more information on the full Resolute plasmid collection, please see www.addgene.org/depositor-collections/re-solute/. Please provide your feedback on this plasmid to the RESOLUTE consortium by filling out their RESOLUTE repository feedback form: https://forms.office.com/Pages/ResponsePage.aspx?id=0e05yklzmkS7rjFGQL4N7z4feCLQvEJAmVcOCM_u885UN1JJRko0Ukg4TVQwNTZLOUxPQVJWT1NHUCQlQCN0PWcu
Proper citation: RRID:Addgene_132173 Copy
Species: Homo sapiens
Genetic Insert: SLC25A22
Vector Backbone Description: Backbone Marker:Thermo Fisher Scientific; Backbone Size:2550; Vector Backbone:pDONR221; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments: For more information on the full Resolute plasmid collection, please see www.addgene.org/depositor-collections/re-solute/. Please provide your feedback on this plasmid to the RESOLUTE consortium by filling out their RESOLUTE repository feedback form: https://forms.office.com/Pages/ResponsePage.aspx?id=0e05yklzmkS7rjFGQL4N7z4feCLQvEJAmVcOCM_u885UN1JJRko0Ukg4TVQwNTZLOUxPQVJWT1NHUCQlQCN0PWcu
Proper citation: RRID:Addgene_132051 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
