Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pR6K-GFP-RFP Resource Report Resource Website |
RRID:Addgene_199652 | Ampicillin | PMID: | Please visit https://www.biorxiv.org/content/10.1101/2023.03.03.531003v1 for bioRxiv preprint. | Backbone Size:999; Vector Backbone:R6k; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2024-08-01 01:05:47 | 0 | |||
|
pmch-mTet1-ZF-CD pc3956 Resource Report Resource Website |
RRID:Addgene_201709 | Tet1-ZF_CD | Mus musculus | Ampicillin | PMID:36056023 | Backbone Marker:our lab; Backbone Size:5924; Vector Backbone:pCAG-mcherry-Tet1CD pc2547; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Zinc finger domain of Tet1 fused to its catalytic domain | 2024-08-01 01:05:54 | 0 | |
|
pR6K-GFP-CASTIF Resource Report Resource Website |
RRID:Addgene_199653 | CAST I-F systems | Synthetic | Ampicillin | PMID: | Please visit https://www.biorxiv.org/content/10.1101/2023.03.03.531003v1 for bioRxiv preprint. | Backbone Size:12736; Vector Backbone:R6k; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2024-08-01 01:05:47 | 0 | |
|
pTn7-SCOUT10 Resource Report Resource Website |
RRID:Addgene_200989 | Ampicillin | PMID:38715147 | Ec100D pir-116 genotype: F- mcrA Δ(mrr-hsdRMS-mcrBC) ϕ80dlacZΔM15 ΔlacX74 recA1 endA1 araD139 Δ(ara, leu)7697 galU galK λ- rpsL nupG pir-116(DHRF) Maintains plasmids at ~250 copies per cell. This strain is naturally resistant to streptomycin | Backbone Marker:Herbert Schweizer; Backbone Size:4356; Vector Backbone:pUC18R6KT-mini-Tn7T-Km; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2024-08-01 01:05:51 | 0 | |||
|
pTn7-SCOUT12 Resource Report Resource Website |
RRID:Addgene_200992 | Ampicillin and Kanamycin | PMID:38715147 | Ec100D pir-116 genotype: F- mcrA Δ(mrr-hsdRMS-mcrBC) ϕ80dlacZΔM15 ΔlacX74 recA1 endA1 araD139 Δ(ara, leu)7697 galU galK λ- rpsL nupG pir-116(DHRF) Maintains plasmids at ~250 copies per cell. This strain is naturally resistant to streptomycin | Backbone Marker:Philip Poole lab; Backbone Size:5262; Vector Backbone:pTn7-SCOUT10; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin | 2024-08-01 01:05:51 | 0 | |||
|
pTn7-SCOUT22 Resource Report Resource Website |
RRID:Addgene_200996 | Ampicillin and Kanamycin | PMID:38715147 | Ec100D pir-116 genotype: F- mcrA Δ(mrr-hsdRMS-mcrBC) ϕ80dlacZΔM15 ΔlacX74 recA1 endA1 araD139 Δ(ara, leu)7697 galU galK λ- rpsL nupG pir-116(DHRF) Maintains plasmids at ~250 copies per cell. This strain is naturally resistant to streptomycin | Backbone Marker:Philip Poole lab; Backbone Size:5565; Vector Backbone:pTn7-SCOUT20; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin | 2024-08-01 01:05:51 | 0 | |||
|
pTn7-SCOUT23 Resource Report Resource Website |
RRID:Addgene_200997 | Ampicillin and Tetracycline | PMID:38715147 | Ec100D pir-116 genotype: F- mcrA Δ(mrr-hsdRMS-mcrBC) ϕ80dlacZΔM15 ΔlacX74 recA1 endA1 araD139 Δ(ara, leu)7697 galU galK λ- rpsL nupG pir-116(DHRF) Maintains plasmids at ~250 copies per cell. This strain is naturally resistant to streptomycin | Backbone Marker:Philip Poole lab; Backbone Size:6696; Vector Backbone:pTn7-SCOUT20; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Tetracycline | 2024-08-01 01:05:51 | 0 | |||
|
pTn7-SCOUT24 Resource Report Resource Website |
RRID:Addgene_200998 | Ampicillin and Spectinomycin | PMID:38715147 | Ec100D pir-116 genotype: F- mcrA Δ(mrr-hsdRMS-mcrBC) ϕ80dlacZΔM15 ΔlacX74 recA1 endA1 araD139 Δ(ara, leu)7697 galU galK λ- rpsL nupG pir-116(DHRF) Maintains plasmids at ~250 copies per cell. This strain is naturally resistant to streptomycin | Backbone Marker:Philip Poole lab; Backbone Size:5556; Vector Backbone:pTn7-SCOUT20; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Spectinomycin | 2024-08-01 01:05:51 | 0 | |||
|
pTn7-SCOUT20 Resource Report Resource Website |
RRID:Addgene_200990 | Ampicillin | PMID:38715147 | Ec100D pir-116 genotype: F- mcrA Δ(mrr-hsdRMS-mcrBC) ϕ80dlacZΔM15 ΔlacX74 recA1 endA1 araD139 Δ(ara, leu)7697 galU galK λ- rpsL nupG pir-116(DHRF) Maintains plasmids at ~250 copies per cell. This strain is naturally resistant to streptomycin | Backbone Marker:Philip Poole lab; Backbone Size:4659; Vector Backbone:pTn7-SCOUT10; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2024-08-01 01:05:51 | 0 | |||
|
pJH1371 Resource Report Resource Website |
RRID:Addgene_199631 | GPI | Ampicillin | PMID:38598630 | Please visit https://www.biorxiv.org/content/10.1101/2021.09.21.461278v4 for bioRxiv preprint. Please note: This plasmid contains a single nucleotide mutation in YFP second half and has CD58 and C. elegans strain Bristol N2 chromosome II sequences instead of UNC-54 3'UTR. These differences are not known to affect plasmid function. | Backbone Size:8542; Vector Backbone:pBSK; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin | 2024-08-01 01:05:47 | 0 | ||
|
pGFP-mVprBP pc2953 Resource Report Resource Website |
RRID:Addgene_201698 | VprBP | Mus musculus | Ampicillin | PMID:36056023 | Backbone Size:8297; Vector Backbone:GFP-TDG (pc2422); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2024-08-01 01:05:53 | 0 | ||
|
AlkB-D135T Resource Report Resource Website |
RRID:Addgene_160433 | E. coli AlkB | Other | Kanamycin | PMID:33337498 | Backbone Size:5295; Vector Backbone:pET-28a(+); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | Changed Aspartic acid 135 to Threonine; deleted the first 11 amino acids | 2024-08-01 01:03:37 | 0 | |
|
pUPD P35S (GB0552) Resource Report Resource Website |
RRID:Addgene_160554 | 35s | Other | Ampicillin | PMID:28053117 | Compatible with GoldenBraid; insert can be released with BsaI | Backbone Marker:self-made; derived from pGEMT-Easy manufactured by Promega; Vector Backbone:pUPD; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin | BsaI and BsmBI sites removed | 2024-08-01 01:03:38 | 0 |
|
AlkB-D135G Resource Report Resource Website |
RRID:Addgene_160434 | E. coli AlkB | Other | Kanamycin | PMID:33337498 | Backbone Size:5295; Vector Backbone:pET-28a(+); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | Changed Aspartic acid 135 to Glycine; deleted the first 11 amino acids | 2024-08-01 01:03:38 | 0 | |
|
pEGFP-2xFYVE Resource Report Resource Website 1+ mentions |
RRID:Addgene_140047 | tandem HRS FYVE domain | Mus musculus | Kanamycin | PMID:10970851 | Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C3; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | two FYVE domains (amino acids 147-223), linked by QGQGS linker | 2024-08-01 01:02:32 | 4 | |
|
pAAV-nEF-Con/Fon-ChRmine-oScarlet Resource Report Resource Website |
RRID:Addgene_137159 | Con/Fon-ChRmine-p2a-oScarlet | Synthetic | Ampicillin | PMID:32574559 | Additional sequencing primers: Intron 2F GGGACGACATGACTTAACCAG; Intron 2R CCAGCCCTTCTCATGTTCAG; Intron 1F CCTGTATGTGACCCATGTGC; Intron 1R: GCACATGGGTCACATACAGG | Backbone Size:4600; Vector Backbone:AAV2-nEF-WPRE; Vector Types:AAV, Cre/Lox, Synthetic Biology, Flp/FRT; Bacterial Resistance:Ampicillin | oScarlet E95D | 2024-08-01 01:02:23 | 0 |
|
pET-Sac-Abeta(MC1-42) Resource Report Resource Website |
RRID:Addgene_127151 | Abeta(MC1-42) | Homo sapiens | Ampicillin | PMID:33793198 | Backbone Size:4700; Vector Backbone:pET vector; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2024-08-01 01:01:52 | 0 | ||
|
pDONR221_SLC17A1 Resource Report Resource Website |
RRID:Addgene_131888 | SLC17A1 | Homo sapiens | Kanamycin | PMID:32265506 | For more information on the full Resolute plasmid collection, please see www.addgene.org/depositor-collections/re-solute/. Please provide your feedback on this plasmid to the RESOLUTE consortium by filling out their RESOLUTE repository feedback form: https://forms.office.com/Pages/ResponsePage.aspx?id=0e05yklzmkS7rjFGQL4N7z4feCLQvEJAmVcOCM_u885UN1JJRko0Ukg4TVQwNTZLOUxPQVJWT1NHUCQlQCN0PWcu | Backbone Marker:Thermo Fisher Scientific; Backbone Size:2550; Vector Backbone:pDONR221; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2024-08-01 01:02:07 | 0 | |
|
pDONR221_SLC7A14 Resource Report Resource Website |
RRID:Addgene_132173 | SLC7A14 | Homo sapiens | Kanamycin | PMID:32265506 | For more information on the full Resolute plasmid collection, please see www.addgene.org/depositor-collections/re-solute/. Please provide your feedback on this plasmid to the RESOLUTE consortium by filling out their RESOLUTE repository feedback form: https://forms.office.com/Pages/ResponsePage.aspx?id=0e05yklzmkS7rjFGQL4N7z4feCLQvEJAmVcOCM_u885UN1JJRko0Ukg4TVQwNTZLOUxPQVJWT1NHUCQlQCN0PWcu | Backbone Marker:Thermo Fisher Scientific; Backbone Size:2550; Vector Backbone:pDONR221; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2024-08-01 01:02:08 | 0 | |
|
pDONR221_SLC25A22 Resource Report Resource Website |
RRID:Addgene_132051 | SLC25A22 | Homo sapiens | Kanamycin | PMID:32265506 | For more information on the full Resolute plasmid collection, please see www.addgene.org/depositor-collections/re-solute/. Please provide your feedback on this plasmid to the RESOLUTE consortium by filling out their RESOLUTE repository feedback form: https://forms.office.com/Pages/ResponsePage.aspx?id=0e05yklzmkS7rjFGQL4N7z4feCLQvEJAmVcOCM_u885UN1JJRko0Ukg4TVQwNTZLOUxPQVJWT1NHUCQlQCN0PWcu | Backbone Marker:Thermo Fisher Scientific; Backbone Size:2550; Vector Backbone:pDONR221; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2024-08-01 01:02:07 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
