Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: dCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG)
Vector Backbone Description: Vector Backbone:pAAV (pUC f1); Vector Types:AAV, CRISPR; Bacterial Resistance:Ampicillin
References:
Comments: Please visit https://doi.org/10.1101/298620 for bioRxiv preprint.
Proper citation: RRID:Addgene_99694 Copy
Species: Mus musculus
Genetic Insert: dCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC)
Vector Backbone Description: Vector Backbone:pAAV (pUC f1); Vector Types:AAV, CRISPR; Bacterial Resistance:Ampicillin
References:
Comments: Please visit https://doi.org/10.1101/298620 for bioRxiv preprint.
Proper citation: RRID:Addgene_99693 Copy
Species: Mus musculus
Genetic Insert: Rufy3 (Mus musculus) recombinant scFV
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pCDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: This is a recombinant antibody derived from RRID: AB_2922752.
Proper citation: RRID:Addgene_190557 Copy
Species: Mus musculus
Genetic Insert: Rufy3 (Mus musculus) recombinant scFV
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pCDNA3.4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: This is a recombinant antibody derived from RRID: AB_2922754.
Proper citation: RRID:Addgene_190559 Copy
Species: Homo sapiens
Genetic Insert: CCR2
Vector Backbone Description: Vector Backbone:PUC19; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
References:
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.09.02.458799v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_186057 Copy
Species: Drosophila melanogaster
Genetic Insert: DmPABPC1
Vector Backbone Description: Vector Backbone:pGEX-6P-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments: ORF extracted from NCBI:NM_166265.2 Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact help@addgene.org before placing your order to request that our lab fully sequence the plasmid.
Proper citation: RRID:Addgene_146647 Copy
Species: Mus musculus
Genetic Insert: mSTING gRNA 2
Vector Backbone Description: Vector Backbone:pLentiCRISPRv2; Vector Types:Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_196626 Copy
Species: Other
Genetic Insert: EBNA2
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2875; Vector Backbone:pENTR223.1; Vector Types:Other, Gateway Entry Vector; Bacterial Resistance:Spectinomycin
References:
Comments:
Proper citation: RRID:Addgene_195815 Copy
Species: Mus musculus
Genetic Insert: mSTING scrambled gRNA 2
Vector Backbone Description: Vector Backbone:pLentiCRISPRv2; Vector Types:Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_196628 Copy
Species: Homo sapiens
Genetic Insert: NTM
Vector Backbone Description: Backbone Size:6106; Vector Backbone:pD649; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: Some plasmids in this collection may have an IS4-like element ISVsa5 family transposase upstream of the CMV promoter.
Proper citation: RRID:Addgene_156726 Copy
Species: Mus musculus
Genetic Insert: mHgs
Vector Backbone Description: Vector Backbone:lenti-guide puro; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
References:
Comments: Please visit https://www.biorxiv.org/content/10.1101/2023.02.17.529028v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_198481 Copy
Species: Homo sapiens
Genetic Insert: CNTN2
Vector Backbone Description: Backbone Size:6106; Vector Backbone:pD649; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: Some plasmids in this collection may have an IS4-like element ISVsa5 family transposase upstream of the CMV promoter.
Proper citation: RRID:Addgene_157016 Copy
Species: Other
Genetic Insert: folA, thyA
Vector Backbone Description: Vector Backbone:pTET-duet; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
References:
Comments: Please visit https://doi.org/10.1101/2023.05.28.542639 for bioRxiv preprint.
Proper citation: RRID:Addgene_191293 Copy
Species: Other
Genetic Insert: folA, thyA
Vector Backbone Description: Vector Backbone:pTET-duet; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
References:
Comments: Please visit https://doi.org/10.1101/2023.05.28.542639 for bioRxiv preprint.
Proper citation: RRID:Addgene_191290 Copy
Species: Other
Genetic Insert: folA, thyA
Vector Backbone Description: Vector Backbone:pTET-duet; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
References:
Comments: Please visit https://doi.org/10.1101/2023.05.28.542639 for bioRxiv preprint.
Proper citation: RRID:Addgene_191297 Copy
Species: Other
Genetic Insert: folA, thyA
Vector Backbone Description: Vector Backbone:pTET-duet; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
References:
Comments: Please visit https://doi.org/10.1101/2023.05.28.542639 for bioRxiv preprint.
Proper citation: RRID:Addgene_191296 Copy
Species: Synthetic
Genetic Insert: tdTomato
Vector Backbone Description: Backbone Marker:N/A; Backbone Size:5200; Vector Backbone:N/A; Vector Types:AAV; Bacterial Resistance:Ampicillin
References:
Comments: Please note that the Addgene Verified sequence contains ambiguous bases due to the GC-rich CAG promoter region.
Proper citation: RRID:Addgene_192552 Copy
Species: Homo sapiens
Genetic Insert: CD19
Vector Backbone Description: Vector Backbone:pCDH-CMV-MCV-EF1-Puro; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_196634 Copy
Species: Danio rerio
Genetic Insert: ZebrafishSTING
Vector Backbone Description: Vector Backbone:pTRIP; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_196633 Copy
Species: Homo sapiens
Genetic Insert: Proliferating Cell Nuclear Antigen
Vector Backbone Description: Backbone Size:4638; Vector Backbone:pET3c; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_190939 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
