Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Xenopus laevis
Genetic Insert: foxd4l1.1
Vector Backbone Description: Vector Backbone:pCS2+; Vector Types:Other, In vitro transcription; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_185517 Copy
Species: Xenopus laevis
Genetic Insert: foxd4l1.1
Vector Backbone Description: Vector Backbone:pCS2+; Vector Types:Other, In vitro transcription; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_185521 Copy
Species: Xenopus laevis
Genetic Insert: foxd4l1.1
Vector Backbone Description: Vector Backbone:pCS2+; Vector Types:Other, In vitro transcription; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_185520 Copy
Species: Xenopus laevis
Genetic Insert: foxd4l1.1
Vector Backbone Description: Vector Backbone:pCS2+; Vector Types:Other, In vitro transcription; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_185503 Copy
Species: Xenopus laevis
Genetic Insert: foxd4l1.1
Vector Backbone Description: Vector Backbone:pCS2+; Vector Types:Other, In vitro transcription; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_185502 Copy
Species: Xenopus laevis
Genetic Insert: cyclin B1
Vector Backbone Description: Backbone Size:4095; Vector Backbone:pCS2+; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_12176 Copy
Species: Xenopus laevis
Genetic Insert: Smurf1-C699A mutant
Vector Backbone Description: Vector Backbone:pCS2+; Vector Types:Other, Xenopus expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_117245 Copy
Species: Xenopus laevis
Genetic Insert: Tbx5-GR
Vector Backbone Description: Vector Backbone:pCS2+; Vector Types:Other, Xenopus expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_117248 Copy
Species: Xenopus laevis
Genetic Insert: Tbx5
Vector Backbone Description: Vector Backbone:pCS2+; Vector Types:Other, Xenopus expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_117247 Copy
Species: Xenopus laevis
Genetic Insert: BMP2
Vector Backbone Description: Vector Backbone:p64T; Vector Types:Other, Xenopus expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_117253 Copy
Species: Xenopus laevis
Genetic Insert: BRAT-EnR
Vector Backbone Description: Vector Backbone:pCS2+; Vector Types:Other, Xenopus expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_117252 Copy
Species: Xenopus laevis
Genetic Insert: BMP4
Vector Backbone Description: Vector Backbone:p64T; Vector Types:Other, Xenopus expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_117254 Copy
Species: Xenopus laevis
Genetic Insert: xlH2B(1-114)
Vector Backbone Description: Backbone Marker:NEB; Backbone Size:6706; Vector Backbone:pTXB1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_118217 Copy
Species: Xenopus laevis
Genetic Insert: xlH2B(1-114)
Vector Backbone Description: Backbone Marker:NEB; Backbone Size:6706; Vector Backbone:pTXB1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_118252 Copy
Species: Xenopus laevis
Genetic Insert: CDK1
Vector Backbone Description: Vector Backbone:pT2/SVNeo, a gift from Perry Hackett (Addgene 26553 – Cui et al., 2002); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: Please also cite the following publication:
Hochegger H, Dejsuphong D, Sonoda E, Saberi A, Rajendra E, Kirk J, Hunt T, Takeda S. An essential role for Cdk1 in S phase control is revealed via chemical genetics in vertebrate cells. J Cell Biol. 2007 Jul 16;178(2):257-68. PubMed PMID: 17635936; PubMed Central PMCID: PMC2064445.
Proper citation: RRID:Addgene_118595 Copy
Species: Xenopus laevis
Genetic Insert: CDK1
Vector Backbone Description: Vector Backbone:pT2/SVNeo, a gift from Perry Hackett (Addgene 26553 – Cui et al., 2002); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: Please also cite the following publication:
Hochegger H, Dejsuphong D, Sonoda E, Saberi A, Rajendra E, Kirk J, Hunt T, Takeda S. An essential role for Cdk1 in S phase control is revealed via chemical genetics in vertebrate cells. J Cell Biol. 2007 Jul 16;178(2):257-68. PubMed PMID: 17635936; PubMed Central PMCID: PMC2064445.
Proper citation: RRID:Addgene_118596 Copy
Species: Xenopus laevis
Genetic Insert: cytXlATL2-R232Q
Vector Backbone Description: Backbone Marker:Pharmacia; Vector Backbone:pGEX-4t-3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_124064 Copy
Species: Xenopus laevis
Genetic Insert: Histone H3
Vector Backbone Description: Backbone Size:4663; Vector Backbone:pQE-81L; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_124100 Copy
Species: Xenopus laevis
Genetic Insert: flotillin 1c
Vector Backbone Description: Backbone Marker:Stragene; Backbone Size:3000; Vector Backbone:pBSII-SK; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_62801 Copy
Species: Xenopus laevis
Genetic Insert: 5'UTR-EcoRV site-3'UTR-pAtrack(55 pA)
Vector Backbone Description: Backbone Marker:Invitrogene; Backbone Size:3900; Vector Backbone:pCRII topo-TA; Vector Types:Other, For cloning a gene for in vitro transcription purposes; Bacterial Resistance:Ampicillin
References:
Comments: This plasmid is intended to be used as a platform for in vitro transcription. GOI can be cloned at EcoRV site in blunt. Template for IVT is obtained by PCR with forward primer consisting on a primer that contains the T7 promoter sequence and part of the 5’UTR (5’ TTGGACCCTCGTACAGAAGCTAATACGACTCACTATAGGGAAATAAGAGAGAAAAGAAGAG 3’) and a 55 polyT (or longer) as reverse primer. No need for polyA polimerase treatment after IVT. Resulting mRNA will contain 5’UTR-GOI-3’UTR-pA (55bp or longer) and it is ready to be transfected.
UTRs are from X. laevis and β-globin gene and can be used for H. sapiens and M. musculus.
Proper citation: RRID:Addgene_101362 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
