Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.addgene.org/191530
Proper Citation: RRID:Addgene_191530
Insert Name: E. coli B F– ompT gal dcm lon hsdSB(rB–mB–) [malB+]K-12(λS) araB::T7RNAP-tetA Δretron-Eco1
Organism: Other
Bacterial Resistance: None
Defining Citation: PMID:34949838
Vector Backbone Description: Vector Backbone:n/a; Vector Types:Other, This is a strain, not a plasmid; Bacterial Resistance:None
Comments: Derived from BL21(AI), grow in LB in BSL1 laboratory conditions Genotype: E. coli B F– ompT gal dcm lon hsdSB(rB–mB–) [malB+]K-12(λS) araB::T7RNAP-tetA Δretron-Eco1 Genotyping primers: CATGTGCATGAAAACCACTGC / CTGGTTGGACGAAGAAGTGC (273 base amplicon)
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for bSLS.114.
No alerts have been found for bSLS.114.
Source: Addgene
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
